USP49

USP49 Antibody
46296-100ul 100ul
EUR 252
USP49 Antibody
46296-50ul 50ul
EUR 187
USP49 Antibody
DF9993 200ul
EUR 304
Description: USP49 Antibody detects endogenous levels of total USP49.
USP49 Antibody
1-CSB-PA025741GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP49. Recognizes USP49 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
USP49 siRNA
20-abx939245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP49 siRNA
20-abx939246
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP49 Antibody
ABD9993 100 ug
EUR 438
anti-USP49
YF-PA25950 50 ul
EUR 334
Description: Mouse polyclonal to USP49
USP49 Blocking Peptide
DF9993-BP 1mg
EUR 195
USP49 Conjugated Antibody
C46296 100ul
EUR 397
USP49 cloning plasmid
CSB-CL761685HU-10ug 10ug
EUR 649
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1923
  • Sequence: atggatagatgcaaacatgtagggcggttacggctcgcccaggaccactccatcctgaaccctcagaagtggtgctgcttagagtgtgccaccaccgagtccgtgtgggcctgcctcaagtgctcccacgtggcctgcggccgctatattgaggaccacgccctgaaacactttg
  • Show more
Description: A cloning plasmid for the USP49 gene.
anti- USP49 antibody
FNab09338 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin specific peptidase 49
  • Uniprot ID: Q70CQ1
  • Gene ID: 25862
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP49
Anti-USP49 antibody
PAab09338 100 ug
EUR 386
USP49 ELISA KIT|Human
EF004146 96 Tests
EUR 689
Human USP49 shRNA Plasmid
20-abx958550
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse USP49 shRNA Plasmid
20-abx981366
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP49 Recombinant Protein (Rat)
RP236135 100 ug Ask for price
USP49 Recombinant Protein (Human)
RP034150 100 ug Ask for price
USP49 Recombinant Protein (Mouse)
RP183476 100 ug Ask for price
Usp49 ORF Vector (Mouse) (pORF)
ORF061160 1.0 ug DNA
EUR 506
Usp49 ORF Vector (Rat) (pORF)
ORF078713 1.0 ug DNA
EUR 506
USP49 ORF Vector (Human) (pORF)
ORF011384 1.0 ug DNA
EUR 95
Ubiquitin Specific Peptidase 49 (USP49) Antibody
20-abx116449
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Usp49 sgRNA CRISPR Lentivector set (Rat)
K6440001 3 x 1.0 ug
EUR 339
USP49 sgRNA CRISPR Lentivector set (Human)
K2601801 3 x 1.0 ug
EUR 339
Usp49 sgRNA CRISPR Lentivector set (Mouse)
K3618101 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 49 (USP49) Antibody
20-abx219287
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 49 (USP49) Antibody
abx239338-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Usp49 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6440002 1.0 ug DNA
EUR 154
Usp49 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6440003 1.0 ug DNA
EUR 154
Usp49 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6440004 1.0 ug DNA
EUR 154
USP49 sgRNA CRISPR Lentivector (Human) (Target 1)
K2601802 1.0 ug DNA
EUR 154
USP49 sgRNA CRISPR Lentivector (Human) (Target 2)
K2601803 1.0 ug DNA
EUR 154
USP49 sgRNA CRISPR Lentivector (Human) (Target 3)
K2601804 1.0 ug DNA
EUR 154
Usp49 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3618102 1.0 ug DNA
EUR 154
Usp49 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3618103 1.0 ug DNA
EUR 154
Usp49 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3618104 1.0 ug DNA
EUR 154
USP49 Protein Vector (Mouse) (pPB-C-His)
PV244638 500 ng
EUR 1065
USP49 Protein Vector (Mouse) (pPB-N-His)
PV244639 500 ng
EUR 1065
USP49 Protein Vector (Mouse) (pPM-C-HA)
PV244640 500 ng
EUR 1065
USP49 Protein Vector (Mouse) (pPM-C-His)
PV244641 500 ng
EUR 1065
USP49 Protein Vector (Rat) (pPB-C-His)
PV314850 500 ng
EUR 1191
USP49 Protein Vector (Rat) (pPB-N-His)
PV314851 500 ng
EUR 1191
USP49 Protein Vector (Rat) (pPM-C-HA)
PV314852 500 ng
EUR 1191
USP49 Protein Vector (Rat) (pPM-C-His)
PV314853 500 ng
EUR 1191
USP49 Protein Vector (Human) (pPB-C-His)
PV045533 500 ng
EUR 329
USP49 Protein Vector (Human) (pPB-N-His)
PV045534 500 ng
EUR 329
USP49 Protein Vector (Human) (pPM-C-HA)
PV045535 500 ng
EUR 329
USP49 Protein Vector (Human) (pPM-C-His)
PV045536 500 ng
EUR 329
Usp49 3'UTR Luciferase Stable Cell Line
TU121683 1.0 ml Ask for price
USP49 3'UTR GFP Stable Cell Line
TU078015 1.0 ml
EUR 2333
Usp49 3'UTR GFP Stable Cell Line
TU171683 1.0 ml Ask for price
Usp49 3'UTR Luciferase Stable Cell Line
TU222954 1.0 ml Ask for price
USP49 3'UTR Luciferase Stable Cell Line
TU028015 1.0 ml
EUR 2333
Usp49 3'UTR GFP Stable Cell Line
TU272954 1.0 ml Ask for price
Human Ubiquitin carboxyl- terminal hydrolase 49, USP49 ELISA KIT
ELI-16738h 96 Tests
EUR 824
Mouse Ubiquitin carboxyl- terminal hydrolase 49, Usp49 ELISA KIT
ELI-28828m 96 Tests
EUR 865
Human Ubiquitin carboxyl-terminal hydrolase 49 (USP49) ELISA Kit
abx384192-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6440005 3 x 1.0 ug
EUR 376
USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2601805 3 x 1.0 ug
EUR 376
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3618105 3 x 1.0 ug
EUR 376
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6440006 1.0 ug DNA
EUR 167
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6440007 1.0 ug DNA
EUR 167
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6440008 1.0 ug DNA
EUR 167
USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2601806 1.0 ug DNA
EUR 167
USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2601807 1.0 ug DNA
EUR 167
USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2601808 1.0 ug DNA
EUR 167
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3618106 1.0 ug DNA
EUR 167
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3618107 1.0 ug DNA
EUR 167
Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3618108 1.0 ug DNA
EUR 167