USP49 Antibody
46296-100ul	SAB	100ul	EUR 252

USP49 Antibody
46296-50ul	SAB	50ul	EUR 187

USP49 Antibody
DF9993	Affbiotech	200ul	EUR 304
Description: USP49 Antibody detects endogenous levels of total USP49.

USP49 Antibody
1-CSB-PA025741GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP49. Recognizes USP49 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

USP49 siRNA
20-abx939245	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP49 siRNA
20-abx939246	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP49 Antibody
ABD9993	Lifescience Market	100 ug	EUR 438

anti-USP49
YF-PA25950	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to USP49

USP49 Blocking Peptide
DF9993-BP	Affbiotech	1mg	EUR 195

USP49 Conjugated Antibody
C46296	SAB	100ul	EUR 397

USP49 cloning plasmid
CSB-CL761685HU-10ug	Cusabio	10ug	EUR 649
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1923 Sequence: atggatagatgcaaacatgtagggcggttacggctcgcccaggaccactccatcctgaaccctcagaagtggtgctgcttagagtgtgccaccaccgagtccgtgtgggcctgcctcaagtgctcccacgtggcctgcggccgctatattgaggaccacgccctgaaacactttg Show more
Description: A cloning plasmid for the USP49 gene.

anti- USP49 antibody
FNab09338	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1：20-1：200 Immunogen: ubiquitin specific peptidase 49 Uniprot ID: Q70CQ1 Gene ID: 25862 Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP49

Anti-USP49 antibody
PAab09338	Lifescience Market	100 ug	EUR 386

USP49 ELISA KIT|Human
EF004146	Lifescience Market	96 Tests	EUR 689

Human USP49 shRNA Plasmid
20-abx958550	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse USP49 shRNA Plasmid
20-abx981366	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

USP49 Recombinant Protein (Rat)
RP236135	ABM	100 ug	Ask for price

USP49 Recombinant Protein (Human)
RP034150	ABM	100 ug	Ask for price

USP49 Recombinant Protein (Mouse)
RP183476	ABM	100 ug	Ask for price

Usp49 ORF Vector (Mouse) (pORF)
ORF061160	ABM	1.0 ug DNA	EUR 506

Usp49 ORF Vector (Rat) (pORF)
ORF078713	ABM	1.0 ug DNA	EUR 506

USP49 ORF Vector (Human) (pORF)
ORF011384	ABM	1.0 ug DNA	EUR 95

Ubiquitin Specific Peptidase 49 (USP49) Antibody
20-abx116449	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Usp49 sgRNA CRISPR Lentivector set (Rat)
K6440001	ABM	3 x 1.0 ug	EUR 339

USP49 sgRNA CRISPR Lentivector set (Human)
K2601801	ABM	3 x 1.0 ug	EUR 339

Usp49 sgRNA CRISPR Lentivector set (Mouse)
K3618101	ABM	3 x 1.0 ug	EUR 339

Ubiquitin Carboxyl-Terminal Hydrolase 49 (USP49) Antibody
20-abx219287	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 49 (USP49) Antibody
abx239338-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Usp49 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6440002	ABM	1.0 ug DNA	EUR 154

Usp49 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6440003	ABM	1.0 ug DNA	EUR 154

Usp49 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6440004	ABM	1.0 ug DNA	EUR 154

USP49 sgRNA CRISPR Lentivector (Human) (Target 1)
K2601802	ABM	1.0 ug DNA	EUR 154

USP49 sgRNA CRISPR Lentivector (Human) (Target 2)
K2601803	ABM	1.0 ug DNA	EUR 154

USP49 sgRNA CRISPR Lentivector (Human) (Target 3)
K2601804	ABM	1.0 ug DNA	EUR 154

Usp49 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3618102	ABM	1.0 ug DNA	EUR 154

Usp49 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3618103	ABM	1.0 ug DNA	EUR 154

Usp49 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3618104	ABM	1.0 ug DNA	EUR 154

USP49 Protein Vector (Mouse) (pPB-C-His)
PV244638	ABM	500 ng	EUR 1065

USP49 Protein Vector (Mouse) (pPB-N-His)
PV244639	ABM	500 ng	EUR 1065

USP49 Protein Vector (Mouse) (pPM-C-HA)
PV244640	ABM	500 ng	EUR 1065

USP49 Protein Vector (Mouse) (pPM-C-His)
PV244641	ABM	500 ng	EUR 1065

USP49 Protein Vector (Rat) (pPB-C-His)
PV314850	ABM	500 ng	EUR 1191

USP49 Protein Vector (Rat) (pPB-N-His)
PV314851	ABM	500 ng	EUR 1191

USP49 Protein Vector (Rat) (pPM-C-HA)
PV314852	ABM	500 ng	EUR 1191

USP49 Protein Vector (Rat) (pPM-C-His)
PV314853	ABM	500 ng	EUR 1191

USP49 Protein Vector (Human) (pPB-C-His)
PV045533	ABM	500 ng	EUR 329

USP49 Protein Vector (Human) (pPB-N-His)
PV045534	ABM	500 ng	EUR 329

USP49 Protein Vector (Human) (pPM-C-HA)
PV045535	ABM	500 ng	EUR 329

USP49 Protein Vector (Human) (pPM-C-His)
PV045536	ABM	500 ng	EUR 329

Usp49 3'UTR Luciferase Stable Cell Line
TU121683	ABM	1.0 ml	Ask for price

USP49 3'UTR GFP Stable Cell Line
TU078015	ABM	1.0 ml	EUR 2333

Usp49 3'UTR GFP Stable Cell Line
TU171683	ABM	1.0 ml	Ask for price

Usp49 3'UTR Luciferase Stable Cell Line
TU222954	ABM	1.0 ml	Ask for price

USP49 3'UTR Luciferase Stable Cell Line
TU028015	ABM	1.0 ml	EUR 2333

Usp49 3'UTR GFP Stable Cell Line
TU272954	ABM	1.0 ml	Ask for price

Human Ubiquitin carboxyl- terminal hydrolase 49, USP49 ELISA KIT
ELI-16738h	Lifescience Market	96 Tests	EUR 824

Mouse Ubiquitin carboxyl- terminal hydrolase 49, Usp49 ELISA KIT
ELI-28828m	Lifescience Market	96 Tests	EUR 865

Human Ubiquitin carboxyl-terminal hydrolase 49 (USP49) ELISA Kit
abx384192-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6440005	ABM	3 x 1.0 ug	EUR 376

USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2601805	ABM	3 x 1.0 ug	EUR 376

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3618105	ABM	3 x 1.0 ug	EUR 376

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6440006	ABM	1.0 ug DNA	EUR 167

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6440007	ABM	1.0 ug DNA	EUR 167

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6440008	ABM	1.0 ug DNA	EUR 167

USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2601806	ABM	1.0 ug DNA	EUR 167

USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2601807	ABM	1.0 ug DNA	EUR 167

USP49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2601808	ABM	1.0 ug DNA	EUR 167

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3618106	ABM	1.0 ug DNA	EUR 167

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3618107	ABM	1.0 ug DNA	EUR 167

Usp49 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3618108	ABM	1.0 ug DNA	EUR 167