  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP28 antibody
70R-21202 50 ul
EUR 435
Description: Rabbit polyclonal USP28 antibody
USP28 Antibody
ABD2258 100 ug
EUR 438
USP28 Antibody
ABD8222 100 ug
EUR 438
USP28 Antibody
40286-100ul 100ul
EUR 252
USP28 Antibody
DF8222 200ul
EUR 304
Description: USP28 Antibody detects endogenous levels of total USP28.
USP28 Antibody
DF2258 200ul
EUR 304
Description: USP28 antibody detects endogenous levels of total USP28.
USP28 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP28. Recognizes USP28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
USP28 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP28. Recognizes USP28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
USP28 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP28. Recognizes USP28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
USP28 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP28. Recognizes USP28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
USP28 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP28. Recognizes USP28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
YF-PA20245 50 ug
EUR 363
Description: Mouse polyclonal to USP28
YF-PA26495 50 ul
EUR 334
Description: Mouse polyclonal to USP28
USP28 Conjugated Antibody
C40286 100ul
EUR 397
anti- USP28 antibody
FNab09322 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin specific peptidase 28
  • Uniprot ID: Q96RU2
  • Gene ID: 57646
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP28
USP28 (pS67) Antibody
abx219277-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
USP28 (pS714) Antibody
abx219278-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
USP28 Rabbit pAb
A10400-100ul 100 ul
EUR 308
USP28 Rabbit pAb
A10400-200ul 200 ul
EUR 459
USP28 Rabbit pAb
A10400-20ul 20 ul
EUR 183
USP28 Rabbit pAb
A10400-50ul 50 ul
EUR 223
USP28 Rabbit pAb
A9292-100ul 100 ul
EUR 308
USP28 Rabbit pAb
A9292-200ul 200 ul
EUR 459
USP28 Rabbit pAb
A9292-20ul 20 ul Ask for price
USP28 Rabbit pAb
A9292-50ul 50 ul Ask for price
USP28 Blocking Peptide
DF8222-BP 1mg
EUR 195
USP28 Blocking Peptide
DF2258-BP 1mg
EUR 195
USP28 cloning plasmid
CSB-CL850427HU-10ug 10ug
EUR 600
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1752
  • Sequence: atgactgcggagctgcagcaggacgacgcggccggcgcggcagacggccacggctcgagctgccaaatgctgttaaatcaactgagagaaatcacaggcattcaggacccttcctttctccatgaagctctgaaggccagtaatggtgacattactcaggcagtcagccttctca
  • Show more
Description: A cloning plasmid for the USP28 gene.
Anti-USP28 antibody
PAab09322 100 ug
EUR 386
PVT17402 2 ug
EUR 231
Anti-USP28 antibody
STJ71620 100 µg
EUR 359
Anti-USP28 antibody
STJ111644 100 µl
EUR 277
Description: The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers.
Anti-USP28 antibody
STJ112436 100 µl
EUR 277
Description: The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers.
Phospho-USP28 (Ser67) Antibody
AF8332 200ul
EUR 376
Description: USP28 (Phospho-Ser67) Antibody detects endogenous levels of USP28 only when phosphorylated at Ser67.
Phospho-USP28 (Ser714) Antibody
AF8333 200ul
EUR 376
Description: USP28 (Phospho-Ser714) Antibody detects endogenous levels of USP28 only when phosphorylated at Ser714.
Polyclonal USP28 Antibody (Internal)
APG01158G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP28 (Internal). This antibody is tested and proven to work in the following applications:
Rat USP28 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-22304c 96 Tests
EUR 928
EF004129 96 Tests
EUR 689
USP28 (Phospho- Ser67) Antibody
ABF8332 100 ug
EUR 438
USP28 (Phospho- Ser714) Antibody
ABF8333 100 ug
EUR 438
USP28 recombinant monoclonal antibody
A5582 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human USP28 for WB ,ELISA
USP28 (Phospho-Ser67) Antibody
12652-100ul 100ul
EUR 252
USP28 (Phospho-Ser67) Antibody
12652-50ul 50ul
EUR 187
USP28 (Phospho-Ser714) Antibody
12653-100ul 100ul
EUR 252
USP28 (Phospho-Ser714) Antibody
12653-50ul 50ul
EUR 187
Mouse USP28 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP28 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-USP28 Monoclonal Antibody
M05040 100ug
EUR 397
Description: Rabbit Monoclonal USP28 Antibody. Validated in IF, WB and tested in Human.
Phospho-USP28 (Ser67) Blocking Peptide
AF8332-BP 1mg
EUR 195
Phospho-USP28 (Ser714) Blocking Peptide
AF8333-BP 1mg
EUR 195
Polyclonal USP28 Antibody (internal region)
APG00553G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP28 (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal USP28 Antibody (N-term)
APR04853G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP28 (N-term). This antibody is tested and proven to work in the following applications:
Usp28 ORF Vector (Rat) (pORF)
ORF078693 1.0 ug DNA
EUR 506
USP28 ORF Vector (Human) (pORF)
ORF011370 1.0 ug DNA
EUR 95
Usp28 ORF Vector (Mouse) (pORF)
ORF061133 1.0 ug DNA
EUR 506
USP28 (Phospho-Ser67) Polyclonal Conjugated Antibody
C12652 100ul
EUR 397
USP28 (Phospho-Ser714) Polyclonal Conjugated Antibody
C12653 100ul
EUR 397
Ubiquitin Specific Peptidase 28 (USP28) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
USP28 sgRNA CRISPR Lentivector set (Human)
K2599701 3 x 1.0 ug
EUR 339
Usp28 sgRNA CRISPR Lentivector set (Mouse)
K4573001 3 x 1.0 ug
EUR 339
Usp28 sgRNA CRISPR Lentivector set (Rat)
K6661101 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
abx031556-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
abx031556-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
abx433433-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 28 (USP28) Antibody
abx239322-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ubiquitin carboxyl-terminal hydrolase 28 (USP28) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin carboxyl-terminal hydrolase 28 (USP28) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.