USP10

USP10 Antibody
25134-100ul 100ul
EUR 390
USP10 antibody
70R-21190 50 ul
EUR 435
Description: Rabbit polyclonal USP10 antibody
USP10 antibody
10R-6239 100 ul
EUR 726
Description: Mouse monoclonal USP10 antibody
USP10 antibody
10R-6240 100 ul
EUR 691
Description: Mouse monoclonal USP10 antibody
USP10 antibody
10R-6241 100 ul
EUR 691
Description: Mouse monoclonal USP10 antibody
USP10 Antibody
49700-100ul 100ul
EUR 333
USP10 Antibody
49700-50ul 50ul
EUR 239
USP10 Antibody
1-CSB-PA613516LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP10. Recognizes USP10 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
USP10 Antibody
DF8061 200ul
EUR 304
Description: USP10 Antibody detects endogenous levels of total USP10.
USP10 Antibody
1-CSB-PA025696GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP10. Recognizes USP10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
Usp10 antibody
70R-9733 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Usp10 antibody
USP10 antibody
70R-9734 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP10 antibody
USP10 siRNA
20-abx905977
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP10 siRNA
20-abx939145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP10 siRNA
20-abx939146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP10 Antibody
ABD8061 100 ug
EUR 438
USP10 antibody
PAab10128 100 ug
EUR 386
anti-USP10
YF-PA16089 50 ul
EUR 363
Description: Mouse polyclonal to USP10
anti-USP10
YF-PA16090 100 ug
EUR 403
Description: Rabbit polyclonal to USP10
anti-USP10
YF-PA27432 50 ug
EUR 363
Description: Mouse polyclonal to USP10
anti-USP10
YF-PA27433 100 ul
EUR 403
Description: Rabbit polyclonal to USP10
USP10 Rabbit pAb
A13387-100ul 100 ul
EUR 308
USP10 Rabbit pAb
A13387-200ul 200 ul
EUR 459
USP10 Rabbit pAb
A13387-20ul 20 ul
EUR 183
USP10 Rabbit pAb
A13387-50ul 50 ul
EUR 223
Usp10 Blocking Peptide
33R-7850 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Usp10 antibody, catalog no. 70R-9733
USP10 Blocking Peptide
DF8061-BP 1mg
EUR 195
USP10 Conjugated Antibody
C49700 100ul
EUR 397
Polyclonal USP10 Antibody
APR06638G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP10 . This antibody is tested and proven to work in the following applications:
USP10 cloning plasmid
CSB-CL613516HU-10ug 10ug
EUR 780
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2397
  • Sequence: atggccctccacagcccgcagtatatttttggagattttagccctgatgaattcaatcaattctttgtgactcctcgatcttcagttgagcttcctccatacagtggaacagttctgtgtggcacacaggctgtggataaactacctgatggacaagaatatcagagaattgagt
  • Show more
Description: A cloning plasmid for the USP10 gene.
USP10 Rabbit mAb
A4454-100ul 100 ul
EUR 410
USP10 Rabbit mAb
A4454-200ul 200 ul
EUR 571
USP10 Rabbit mAb
A4454-20ul 20 ul
EUR 221
USP10 Rabbit mAb
A4454-50ul 50 ul
EUR 287
USP10 Rabbit pAb
A7505-100ul 100 ul
EUR 308
USP10 Rabbit pAb
A7505-200ul 200 ul
EUR 459
USP10 Rabbit pAb
A7505-20ul 20 ul
EUR 183
USP10 Rabbit pAb
A7505-50ul 50 ul
EUR 223
USP10 Rabbit pAb
A3349-100ul 100 ul
EUR 308
USP10 Rabbit pAb
A3349-200ul 200 ul
EUR 459
USP10 Rabbit pAb
A3349-20ul 20 ul Ask for price
USP10 Rabbit pAb
A3349-50ul 50 ul Ask for price
anti- USP10 antibody
FNab09304 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IF: 1:10-1:100
  • Immunogen: ubiquitin specific peptidase 10
  • Uniprot ID: Q14694
  • Gene ID: 9100
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP10
anti- USP10 antibody
FNab10128 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50-1:200
  • IF: 1:20-1:100
  • Immunogen: ubiquitin specific peptidase 10
  • Uniprot ID: Q14694
  • Gene ID: 9100
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP10
Anti-USP10 antibody
PAab09304 100 ug
EUR 386
Anti-USP10 antibody
STJ111186 100 µl
EUR 277
Description: Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene.
Anti-USP10 antibody
STJ115349 100 µl
EUR 277
Description: Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene.
Anti-USP10 antibody
STJ29641 100 µl
EUR 277
Description: Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene.
USP10 Antibody, HRP conjugated
1-CSB-PA613516LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP10. Recognizes USP10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP10 Antibody, FITC conjugated
1-CSB-PA613516LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP10. Recognizes USP10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP10 Antibody, Biotin conjugated
1-CSB-PA613516LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP10. Recognizes USP10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal USP10 Antibody (Center)
APR04188G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP10 (Center). This antibody is tested and proven to work in the following applications:
USP10 ELISA KIT|Human
EF004114 96 Tests
EUR 689
Bovine USP10 ELISA KIT
ELI-51886b 96 Tests
EUR 928
Rat USP10 shRNA Plasmid
20-abx989457
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse USP10 shRNA Plasmid
20-abx973298
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP10 shRNA Plasmid
20-abx956013
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP10 recombinant monoclonal antibody
A5925 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human USP10 for WB, IF,ELISA
Chicken USP10 ELISA KIT
ELI-40397c 96 Tests
EUR 928
Anti-USP10 Monoclonal Antibody
M03786 100ug
EUR 397
Description: Rabbit Monoclonal USP10 Antibody. Validated in IP, IF, WB and tested in Human.
USP10 Recombinant Protein (Rat)
RP236030 100 ug Ask for price
USP10 Recombinant Protein (Human)
RP034075 100 ug Ask for price
USP10 Recombinant Protein (Mouse)
RP183320 100 ug Ask for price
Polyclonal USP10 Antibody (N-Terminus)
APR02754G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP10 (N-Terminus). This antibody is tested and proven to work in the following applications:
Usp10 ORF Vector (Mouse) (pORF)
ORF061108 1.0 ug DNA
EUR 506
Usp10 ORF Vector (Rat) (pORF)
ORF078678 1.0 ug DNA
EUR 506
USP10 ORF Vector (Human) (pORF)
ORF011359 1.0 ug DNA
EUR 95
Ubiquitin Specific Peptidase 10 (USP10) Antibody
20-abx007001
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 10 (USP10) Antibody
20-abx116424
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 10 (USP10) Antibody
20-abx127077
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 10 (USP10) Antibody
20-abx142301
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 10 (USP10) Antibody
abx029351-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 10 (USP10) Antibody
abx029351-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 10 (USP10) Antibody
abx239304-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ubiquitin specific peptidase 10 (USP10) Antibody
20-abx338840
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.