UCHL5

UCHL5 antibody
70R-3208 50 ug
EUR 467
Description: Rabbit polyclonal UCHL5 antibody raised against the middle region of UCHL5
UCHL5 Antibody
36168-100ul 100ul
EUR 252
UCHL5 Antibody
6129-50
EUR 207
UCHL5 Antibody
DF8203 200ul
EUR 304
Description: UCHL5 Antibody detects endogenous levels of total UCHL5.
UCHL5 Antibody
1-CSB-PA561195
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCHL5. Recognizes UCHL5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
UCHL5 Antibody
1-CSB-PA195221
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCHL5. Recognizes UCHL5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
UCHL5 antibody
70R-9729 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UCHL5 antibody
UCHL5 antibody
70R-9730 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UCHL5 antibody
UCHL5 Antibody
1-CSB-PA025544GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UCHL5. Recognizes UCHL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
UCHL5 siRNA
20-abx938910
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCHL5 siRNA
20-abx938911
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCHL5 Antibody
ABD8203 100 ug
EUR 438
UCHL5 Antibody
ABD8328 100 ug
EUR 438
UCHL5 Blocking Peptide
33R-1959 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL5 antibody, catalog no. 70R-3208
UCHL5 Blocking Peptide
33R-4642 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL5 antibody, catalog no. 70R-9729
UCHL5 Blocking Peptide
33R-6873 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UCHL5 antibody, catalog no. 70R-9730
Human Recombinant UCHL5
6359-100
EUR 457
UCHL5 cloning plasmid
CSB-CL896738HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 987
  • Sequence: atgacgggcaatgccggggagtggtgcctcatggaaagcgaccccggggtcttcaccgagctcattaaaggattcggttgccgaggagcccaagtagaagaaatatggagtttagagcctgagaattttgaaaaattaaagccagttcatgggttaatttttcttttcaagtggca
  • Show more
Description: A cloning plasmid for the UCHL5 gene.
UCHL5 cloning plasmid
CSB-CL896738HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atgacgggcaatgccggggagtggtgcctcatggaaagcgaccccggggtcttcaccgagctcattaaaggattcggttgccgaggagcccaagtagaagaaatatggagtttagagcctgagaattttgaaaaattaaagccagttcatgggttaatttttcttttcaagtggca
  • Show more
Description: A cloning plasmid for the UCHL5 gene.
Polyclonal UCHL5 Antibody
APC00001G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human UCHL5 . This antibody is tested and proven to work in the following applications:
UCHL5 Blocking Peptide
DF8203-BP 1mg
EUR 195
UCHL5 Conjugated Antibody
C36168 100ul
EUR 397
UCHL5 Rabbit pAb
A7978-100ul 100 ul
EUR 308
UCHL5 Rabbit pAb
A7978-200ul 200 ul
EUR 459
UCHL5 Rabbit pAb
A7978-20ul 20 ul
EUR 183
UCHL5 Rabbit pAb
A7978-50ul 50 ul
EUR 223
anti- UCHL5 antibody
FNab09220 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC:1:20-1:200
  • Immunogen: ubiquitin carboxyl-terminal hydrolase L5
  • Uniprot ID: Q9Y5K5
  • Gene ID: 51377
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UCHL5
Anti-UCHL5 antibody
PAab09220 100 ug
EUR 386
pCMV-SPORT6-UCHL5
PVT13925 2 ug
EUR 391
Anti-UCHL5 antibody
STJ110285 100 µl
EUR 277
Polyclonal UCHL5 Antibody (Center)
APR04508G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCHL5 (Center). This antibody is tested and proven to work in the following applications:
UCHL5 protein (His tag)
80R-1826 100 ug
EUR 305
Description: Purified recombinant UCHL5 protein
Human UCHL5 ELISA KIT
ELI-16742h 96 Tests
EUR 824
Bovine UCHL5 ELISA KIT
ELI-17882b 96 Tests
EUR 928
UCHL5 ELISA KIT|Human
EF004044 96 Tests
EUR 689
Mouse UCHL5 shRNA Plasmid
20-abx974646
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UCHL5 shRNA Plasmid
20-abx959733
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Uchl5 ELISA KIT
ELI-40409m 96 Tests
EUR 865
UCHL5 Recombinant Protein (Rat)
RP235718 100 ug Ask for price
UCHL5 Recombinant Protein (Human)
RP033865 100 ug Ask for price
UCHL5 Recombinant Protein (Human)
RP033868 100 ug Ask for price
UCHL5 Recombinant Protein (Mouse)
RP182912 100 ug Ask for price
UCHL5 Recombinant Protein (Mouse)
RP182915 100 ug Ask for price
Uchl5 ORF Vector (Mouse) (pORF)
ORF060972 1.0 ug DNA
EUR 506
Uchl5 ORF Vector (Mouse) (pORF)
ORF060973 1.0 ug DNA
EUR 506
Uchl5 ORF Vector (Rat) (pORF)
ORF078574 1.0 ug DNA
EUR 506
UCHL5 ORF Vector (Human) (pORF)
ORF011289 1.0 ug DNA
EUR 95
UCHL5 ORF Vector (Human) (pORF)
ORF011290 1.0 ug DNA
EUR 95
Polyclonal UCH37 (UCHL5) Antibody (N-term)
APR04802G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCH37 (UCHL5) (N-term). This antibody is tested and proven to work in the following applications:
Uchl5 sgRNA CRISPR Lentivector set (Rat)
K6162901 3 x 1.0 ug
EUR 339
Uchl5 sgRNA CRISPR Lentivector set (Mouse)
K4831901 3 x 1.0 ug
EUR 339
UCHL5 sgRNA CRISPR Lentivector set (Human)
K2580801 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx007186
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx211803
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx212703
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx104211
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx104212
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx104213
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Ubiquitin Carboxyl-Terminal Hydrolase L5 (UCHL5) Antibody
20-abx116414
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
20-abx123416
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
abx122731-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
abx031361-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
abx031361-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl Terminal Hydrolase L5 (UCHL5) Antibody
abx239220-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Monoclonal UCH37(UCHL5) Antibody(Ascites), Clone: 854CT5.5.6
AMM02458G 100μl
EUR 484
Description: A Monoclonal antibody against Human UCH37(UCHL5)(Ascites). The antibodies are raised in Mouse and are from clone 854CT5.5.6. This antibody is applicable in WB, E
Uchl5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6162902 1.0 ug DNA
EUR 154
Uchl5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6162903 1.0 ug DNA
EUR 154
Uchl5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6162904 1.0 ug DNA
EUR 154
Uchl5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4831902 1.0 ug DNA
EUR 154
Uchl5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4831903 1.0 ug DNA
EUR 154
Uchl5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4831904 1.0 ug DNA
EUR 154
UCHL5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2580802 1.0 ug DNA
EUR 154
UCHL5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2580803 1.0 ug DNA
EUR 154
UCHL5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2580804 1.0 ug DNA
EUR 154
UCHL5 Protein Vector (Mouse) (pPB-C-His)
PV243886 500 ng
EUR 603