TRAF6

Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
DLR-TRAF6-Hu-96T 96T
EUR 673
  • Should the Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TNF Receptor Associated Factor 6 (TRAF6) in samples from tissue homogenates, cell lysates or other biological fluids.
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RDR-TRAF6-Hu-48Tests 48 Tests
EUR 544
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RDR-TRAF6-Hu-96Tests 96 Tests
EUR 756
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RD-TRAF6-Hu-48Tests 48 Tests
EUR 521
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RD-TRAF6-Hu-96Tests 96 Tests
EUR 723
Traf6/ Rat Traf6 ELISA Kit
ELI-07631r 96 Tests
EUR 886
TRAF6 Antibody
24191-100ul 100ul
EUR 390
TRAF6 antibody
20R-1646 100 ug
EUR 673
Description: Rabbit polyclonal TRAF6 antibody
TRAF6 Antibody
31136-100ul 100ul
EUR 252
TRAF6 Antibody
31136-50ul 50ul
EUR 187
TRAF6 antibody
70R-11914 100 ug
EUR 403
Description: Rabbit polyclonal TRAF6 antibody
TRAF6 antibody
70R-20958 50 ul
EUR 435
Description: Rabbit polyclonal TRAF6 antibody
TRAF6 Antibody
48177-100ul 100ul
EUR 333
TRAF6 Antibody
48177-50ul 50ul
EUR 239
TRAF6 Antibody
3566-100
EUR 370
TRAF6 Antibody
3566R-100
EUR 316
TRAF6 Antibody
3566R-30T
EUR 146
TRAF6 Antibody
32102-100ul 100ul
EUR 252
TRAF6 Antibody
1-CSB-PA004325
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
TRAF6 Antibody
1-CSB-PA097438
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50
TRAF6 Antibody
1-CSB-PA954966
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
TRAF6 Antibody
DF6155 200ul
EUR 304
Description: TRAF6 Antibody detects endogenous levels of total TRAF6.
TRAF6 antibody
70R-35577 100 ug
EUR 349
Description: Purified Rabbit polyclonal TRAF6 antibody
TRAF6 antibody
70R-7829 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRAF6 antibody
TRAF6 Antibody
AF5376 200ul
EUR 304
Description: TRAF6 Antibody detects endogenous levels of total TRAF6.
TRAF6 Antibody
1-CSB-PA024154GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
TRAF6 Antibody
1-CSB-PA024154LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
TRAF6 siRNA
20-abx905764
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF6 siRNA
20-abx937917
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF6 siRNA
20-abx937918
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF6 Antibody
ABF5376 100 ug
EUR 438
TRAF6 Antibody
ABD6155 100 ug
EUR 438
TRAF6 Peptide
H-7604.0001 1.0mg
EUR 506
Description: Sum Formula: C145H238N34O44; CAS# [852805-92-6] net
TRAF6- S12F
PVT10107 2 ug
EUR 301
TRAF6 Plasmid
PVT7119 2 ug
EUR 266
anti-TRAF6
YF-PA15127 50 ug
EUR 363
Description: Mouse polyclonal to TRAF6
anti-TRAF6
YF-PA15128 100 ul
EUR 403
Description: Rabbit polyclonal to TRAF6
anti-TRAF6
YF-PA15129 100 ug
EUR 403
Description: Rabbit polyclonal to TRAF6
anti-TRAF6
YF-PA24895 50 ul
EUR 334
Description: Mouse polyclonal to TRAF6
TRAF6 Rabbit pAb
A0973-100ul 100 ul
EUR 308
TRAF6 Rabbit pAb
A0973-200ul 200 ul
EUR 459
TRAF6 Rabbit pAb
A0973-20ul 20 ul
EUR 183
TRAF6 Rabbit pAb
A0973-50ul 50 ul
EUR 223
TRAF6 Blocking Peptide
33R-10288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF6 antibody, catalog no. 70R-7829
TRAF6 Blocking Peptide
33R-10807 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF6 antibody, catalog no. 70R-11914
TRAF6 Blocking Peptide
3566BP-50
EUR 153
TRAF6 Polyclonal Antibody
41510-100ul 100ul
EUR 252
TRAF6 Polyclonal Antibody
41510-50ul 50ul
EUR 187
Polyclonal TRAF6 Antibody
APR02689G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF6 . This antibody is tested and proven to work in the following applications:
Polyclonal TRAF6 Antibody
APR03191G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF6 . This antibody is tested and proven to work in the following applications:
TRAF6 Blocking Peptide
DF6155-BP 1mg
EUR 195
Anti-TRAF6 Antibody
A00185 100ug/vial
EUR 334
TRAF6 Blocking Peptide
20-abx061739
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TRAF6 Blocking Peptide
AF5376-BP 1mg
EUR 195
TRAF6 Conjugated Antibody
C32102 100ul
EUR 397
TRAF6 Conjugated Antibody
C31136 100ul
EUR 397
Polyclonal TRAF6 Antibody
APR06317G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF6 . This antibody is tested and proven to work in the following applications:
TRAF6 cloning plasmid
CSB-CL024154HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgagtctgctaaactgtgaaaacagctgtggattcagccagtctgaaagtgactgctgtgtggccatggccagctcctgtagcgctgtaacaaaagatgatagtgtgggtggaactgccagcacggggaacctctccagctcatttatggaggagatccagggatatgatgtag
  • Show more
Description: A cloning plasmid for the TRAF6 gene.
TRAF6 Polyclonal Antibody
ABP52637-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF6
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF6 from Human, Mouse, Rat. This TRAF6 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF6
TRAF6 Polyclonal Antibody
ABP52637-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF6
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF6 from Human, Mouse, Rat. This TRAF6 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF6
TRAF6 Polyclonal Antibody
ABP52637-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF6
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF6 from Human, Mouse, Rat. This TRAF6 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF6
TRAF6 Polyclonal Antibody
A54437 100 µg
EUR 570.55
Description: Ask the seller for details
TRAF6 Rabbit pAb
A16991-100ul 100 ul
EUR 308
TRAF6 Rabbit pAb
A16991-200ul 200 ul
EUR 459
TRAF6 Rabbit pAb
A16991-20ul 20 ul
EUR 183
TRAF6 Rabbit pAb
A16991-50ul 50 ul
EUR 223
anti- TRAF6 antibody
FNab08921 100µg
EUR 548.75
  • Immunogen: TNF receptor-associated factor 6
  • Uniprot ID: Q9Y4K3
  • Gene ID: 7189
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Immunology, Developmental biology
Description: Antibody raised against TRAF6
TRAF6 Control Peptide
H-7606.0001 1.0mg
EUR 506
Description: Sum Formula: C139H232N34O42; CAS# [852690-80-3] net
TRAF6 Polyclonal Antibody
ES3636-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRAF6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TRAF6 Polyclonal Antibody
ES3636-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAF6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Anti-TRAF6 Antibody
PA2221 100ug/vial
EUR 334
Anti-TRAF6 antibody
PAab08921 100 ug
EUR 386
Anti-TRAF6 Antibody
PB9517 100ug/vial
EUR 294
Anti-TRAF6 antibody
STJ25955 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported.
Anti-TRAF6 antibody
STJ119291 100 µl
EUR 277