TRAF6

Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
DLR-TRAF6-Hu-96T 96T
EUR 673
  • Should the Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TNF Receptor Associated Factor 6 (TRAF6) in samples from tissue homogenates, cell lysates or other biological fluids.
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RDR-TRAF6-Hu-48Tests 48 Tests
EUR 544
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RDR-TRAF6-Hu-96Tests 96 Tests
EUR 756
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RD-TRAF6-Hu-48Tests 48 Tests
EUR 521
Human TNF Receptor Associated Factor 6 (TRAF6) ELISA Kit
RD-TRAF6-Hu-96Tests 96 Tests
EUR 723
Traf6/ Rat Traf6 ELISA Kit
ELI-07631r 96 Tests
EUR 886
TRAF6 Antibody
AF5376 200ul
EUR 304
Description: TRAF6 Antibody detects endogenous levels of total TRAF6.
TRAF6 siRNA
20-abx905764
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF6 Peptide
H-7604.0001 1.0mg
EUR 506
Description: Sum Formula: C145H238N34O44; CAS# [852805-92-6] net
TRAF6 Antibody
ABF5376 100 ug
EUR 438
TRAF6 siRNA
20-abx937917
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF6 siRNA
20-abx937918
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAF6 antibody
70R-35577 100 ug
EUR 349
Description: Purified Rabbit polyclonal TRAF6 antibody
TRAF6 antibody
70R-20958 50 ul
EUR 435
Description: Rabbit polyclonal TRAF6 antibody
TRAF6 antibody
70R-7829 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRAF6 antibody
TRAF6 Antibody
ABD6155 100 ug
EUR 438
TRAF6 Antibody
3566-100
EUR 370
TRAF6 Antibody
3566R-100
EUR 316
TRAF6 Antibody
3566R-30T
EUR 146
TRAF6 Antibody
48177-100ul 100ul
EUR 333
TRAF6 Antibody
48177-50ul 50ul
EUR 239
TRAF6 Antibody
31136-100ul 100ul
EUR 252
TRAF6 Antibody
31136-50ul 50ul
EUR 187
TRAF6 Antibody
32102-100ul 100ul
EUR 252
TRAF6 Antibody
24191-100ul 100ul
EUR 390
TRAF6 antibody
20R-1646 100 ug
EUR 673
Description: Rabbit polyclonal TRAF6 antibody
TRAF6 antibody
70R-11914 100 ug
EUR 403
Description: Rabbit polyclonal TRAF6 antibody
TRAF6 Antibody
DF6155 200ul
EUR 304
Description: TRAF6 Antibody detects endogenous levels of total TRAF6.
TRAF6 Antibody
1-CSB-PA954966
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
TRAF6 Antibody
1-CSB-PA004325
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
TRAF6 Antibody
1-CSB-PA097438
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50
TRAF6 Antibody
1-CSB-PA024154GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
TRAF6 Antibody
1-CSB-PA024154LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAF6. Recognizes TRAF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
TRAF6 Plasmid
PVT7119 2 ug
EUR 266
TRAF6- S12F
PVT10107 2 ug
EUR 301
anti-TRAF6
YF-PA15127 50 ug
EUR 363
Description: Mouse polyclonal to TRAF6
anti-TRAF6
YF-PA15128 100 ul
EUR 403
Description: Rabbit polyclonal to TRAF6
anti-TRAF6
YF-PA15129 100 ug
EUR 403
Description: Rabbit polyclonal to TRAF6
anti-TRAF6
YF-PA24895 50 ul
EUR 334
Description: Mouse polyclonal to TRAF6
Polyclonal TRAF6 Antibody
APR02689G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF6 . This antibody is tested and proven to work in the following applications:
Polyclonal TRAF6 Antibody
APR03191G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF6 . This antibody is tested and proven to work in the following applications:
TRAF6 Blocking Peptide
AF5376-BP 1mg
EUR 195
Polyclonal TRAF6 Antibody
APR06317G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF6 . This antibody is tested and proven to work in the following applications:
TRAF6 Conjugated Antibody
C31136 100ul
EUR 397
TRAF6 Conjugated Antibody
C32102 100ul
EUR 397
TRAF6 cloning plasmid
CSB-CL024154HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgagtctgctaaactgtgaaaacagctgtggattcagccagtctgaaagtgactgctgtgtggccatggccagctcctgtagcgctgtaacaaaagatgatagtgtgggtggaactgccagcacggggaacctctccagctcatttatggaggagatccagggatatgatgtag
  • Show more
Description: A cloning plasmid for the TRAF6 gene.
TRAF6 Control Peptide
H-7606.0001 1.0mg
EUR 506
Description: Sum Formula: C139H232N34O42; CAS# [852690-80-3] net
anti- TRAF6 antibody
FNab08921 100µg
EUR 548.75
  • Immunogen: TNF receptor-associated factor 6
  • Uniprot ID: Q9Y4K3
  • Gene ID: 7189
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Immunology, Developmental biology
Description: Antibody raised against TRAF6
TRAF6 Polyclonal Antibody
ES3636-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRAF6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TRAF6 Polyclonal Antibody
ES3636-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAF6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TRAF6 Polyclonal Antibody
ABP52637-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF6
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF6 from Human, Mouse, Rat. This TRAF6 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF6
TRAF6 Polyclonal Antibody
ABP52637-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF6
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF6 from Human, Mouse, Rat. This TRAF6 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF6
TRAF6 Polyclonal Antibody
ABP52637-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRAF6
  • Applications tips:
Description: A polyclonal antibody for detection of TRAF6 from Human, Mouse, Rat. This TRAF6 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRAF6
TRAF6 Blocking Peptide
20-abx061739
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Anti-TRAF6 Antibody
A00185 100ug/vial
EUR 334
TRAF6 Rabbit pAb
A0973-100ul 100 ul
EUR 308
TRAF6 Rabbit pAb
A0973-200ul 200 ul
EUR 459
TRAF6 Rabbit pAb
A0973-20ul 20 ul
EUR 183
TRAF6 Rabbit pAb
A0973-50ul 50 ul
EUR 223
TRAF6 Polyclonal Antibody
A54437 100 µg
EUR 570.55
Description: Ask the seller for details
TRAF6 Rabbit pAb
A16991-100ul 100 ul
EUR 308
TRAF6 Rabbit pAb
A16991-200ul 200 ul
EUR 459
TRAF6 Rabbit pAb
A16991-20ul 20 ul
EUR 183
TRAF6 Rabbit pAb
A16991-50ul 50 ul
EUR 223
TRAF6 Blocking Peptide
33R-10288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF6 antibody, catalog no. 70R-7829
TRAF6 Blocking Peptide
33R-10807 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF6 antibody, catalog no. 70R-11914
TRAF6 Blocking Peptide
3566BP-50
EUR 153
TRAF6 Polyclonal Antibody
41510-100ul 100ul
EUR 252
TRAF6 Polyclonal Antibody
41510-50ul 50ul
EUR 187
TRAF6 Blocking Peptide
DF6155-BP 1mg
EUR 195
Anti-TRAF6 Antibody
PB9517 100ug/vial
EUR 294
Anti-TRAF6 antibody
PAab08921 100 ug
EUR 386
Anti-TRAF6 Antibody
PA2221 100ug/vial
EUR 334
Anti-TRAF6 Antibody
STJ503381 100 µg
EUR 476
Anti-TRAF6 antibody
STJ96085 200 µl
EUR 197
Description: Rabbit polyclonal to TRAF6.