tox

TOX siRNA
20-abx937788
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TOX antibody
70R-8006 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TOX antibody
TOX Antibody
25524-100ul 100ul
EUR 390
TOX Antibody
1-CSB-PA024073LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500
TOX cloning plasmid
CSB-CL024073HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1581
  • Sequence: atggacgtaagattttatccacctgtagcccagcccgccgctgcgcccgacgctccctgtctgggaccttctccctgcctggacccctactattgcaacaagtttgacggtgagaacatgtatatgagcatgacagagccgagccaggactatgtgccagccagccagtcctacc
  • Show more
Description: A cloning plasmid for the TOX gene.
ToX Antigen (ROP)
E61Y00303 1mg
EUR 700
ToX Antigen (MIC3)
E61Y00304 1mg
EUR 700
ToX Antigen (GRA6)
E61Y00306 1mg
EUR 700
TOX Rabbit pAb
A7050-100ul 100 ul
EUR 308
TOX Rabbit pAb
A7050-200ul 200 ul
EUR 459
TOX Rabbit pAb
A7050-20ul 20 ul
EUR 183
TOX Rabbit pAb
A7050-50ul 50 ul
EUR 223
Anti-TOX Antibody
A08441 100 ug
EUR 397
Description: Rabbit Polyclonal TOX Antibody. Validated in IHC, WB and tested in Human.
TOX Polyclonal Antibody
A68731 100 ?g
EUR 628.55
Description: reagents widely cited
TOX Blocking Peptide
33R-1732 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TOX antibody, catalog no. 70R-8006
TOX Polyclonal Antibody
30803-100ul 100ul
EUR 252
TOX Polyclonal Antibody
30803-50ul 50ul
EUR 187
Anti-TOX antibody
STJ29130 100 µl
EUR 277
Description: The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.
TOX Polyclonal Conjugated Antibody
C30803 100ul
EUR 397
Mouse TOX shRNA Plasmid
20-abx982838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ToX Antigen (P30,SAG1)
E61Y00301 1mg
EUR 700
ToX Antigen (P29,GRA7)
E61Y00302 1mg
EUR 700
ToX Antigen (P24,GRA1)
E61Y00305 1mg
EUR 700
TOX ELISA KIT|Human
EF005649 96 Tests
EUR 689
Human TOX ELISA KIT
ELI-51940h 96 Tests
EUR 824
Mouse Tox ELISA KIT
ELI-45511m 96 Tests
EUR 865
Diphtheria Toxin (tox) Antibody
abx411295-01mg 0.1 mg
EUR 592
  • Shipped within 1 week.
Diphtheria Toxin (tox) Antibody
abx411297-1ml 1 ml
EUR 509
  • Shipped within 1 week.
Human TOX shRNA Plasmid
20-abx956525
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TOX Antibody, HRP conjugated
1-CSB-PA024073LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TOX Antibody, FITC conjugated
1-CSB-PA024073LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TOX Antibody, Biotin conjugated
1-CSB-PA024073LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TOX Recombinant Protein (Human)
RP032593 100 ug Ask for price
TOX Recombinant Protein (Rat)
RP234284 100 ug Ask for price
TOX Recombinant Protein (Mouse)
RP180623 100 ug Ask for price
Thymocyte Selection-Associated High Mobility Group Box Protein TOX (TOX) Antibody
20-abx005337
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody
20-abx338585
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody (HRP)
20-abx337960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody (FITC)
20-abx337961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody (Biotin)
20-abx337962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Tox IgG ELISA Kit
EHT0037 96Tests
EUR 521
Human Tox IgM ELISA Kit
EHT0038 96Tests
EUR 521
Human Tox IgA ELISA Kit
EHT0039 96Tests
EUR 521
Human Tox IgD ELISA Kit
EHT0040 96Tests
EUR 521
Goat Tox IgG ELISA Kit
EGTT0037 96Tests
EUR 521
Goat Tox IgM ELISA Kit
EGTT0038 96Tests
EUR 521
Goat Tox IgA ELISA Kit
EGTT0039 96Tests
EUR 521
Goat Tox IgD ELISA Kit
EGTT0040 96Tests
EUR 521
Bovine Tox IgG ELISA Kit
EBT0037 96Tests
EUR 521
Bovine Tox IgM ELISA Kit
EBT0038 96Tests
EUR 521
Bovine Tox IgA ELISA Kit
EBT0039 96Tests
EUR 521
Bovine Tox IgD ELISA Kit
EBT0040 96Tests
EUR 521
Anserine Tox IgG ELISA Kit
EAT0037 96Tests
EUR 521
Anserine Tox IgM ELISA Kit
EAT0038 96Tests
EUR 521
Anserine Tox IgA ELISA Kit
EAT0039 96Tests
EUR 521
Anserine Tox IgD ELISA Kit
EAT0040 96Tests
EUR 521
Canine Tox IgG ELISA Kit
ECT0037 96Tests
EUR 521
Canine Tox IgM ELISA Kit
ECT0038 96Tests
EUR 521
Canine Tox IgA ELISA Kit
ECT0039 96Tests
EUR 521
Canine Tox IgD ELISA Kit
ECT0040 96Tests
EUR 521
Porcine Tox IgG ELISA Kit
EPT0037 96Tests
EUR 521
Porcine Tox IgM ELISA Kit
EPT0038 96Tests
EUR 521
Porcine Tox IgA ELISA Kit
EPT0039 96Tests
EUR 521
Porcine Tox IgD ELISA Kit
EPT0040 96Tests
EUR 521
Rat Tox IgG ELISA Kit
ERT0037 96Tests
EUR 521
Rat Tox IgM ELISA Kit
ERT0038 96Tests
EUR 521
Rat Tox IgA ELISA Kit
ERT0039 96Tests
EUR 521
Rat Tox IgD ELISA Kit
ERT0040 96Tests
EUR 521
Rabbit Tox IgG ELISA Kit
ERTT0037 96Tests
EUR 521
Rabbit Tox IgM ELISA Kit
ERTT0038 96Tests
EUR 521
Rabbit Tox IgA ELISA Kit
ERTT0039 96Tests
EUR 521
Rabbit Tox IgD ELISA Kit
ERTT0040 96Tests
EUR 521
Mouse Tox IgG ELISA Kit
EMT0037 96Tests
EUR 521
Mouse Tox IgM ELISA Kit
EMT0038 96Tests
EUR 521
Mouse Tox IgA ELISA Kit
EMT0039 96Tests
EUR 521