Western Blot antibodies to the MPDU1 Gene

Rabbit Polyclonals


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MPDU1 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 cloning plasmid

CSB-CL014744HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagct
  • Show more
Description: A cloning plasmid for the MPDU1 gene.

MPDU1 Polyclonal Antibody

A62970 100 µg
EUR 570.55
Description: The best epigenetics products

MPDU1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPDU1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPDU1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


ELI-14234h 96 Tests
EUR 824

Mouse Mpdu1 ELISA KIT

ELI-16579m 96 Tests
EUR 865

Human MPDU1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPDU1 Recombinant Protein (Human)

RP019753 100 ug Ask for price

MPDU1 Recombinant Protein (Mouse)

RP151229 100 ug Ask for price

MPDU1 Recombinant Protein (Rat)

RP212120 100 ug Ask for price

MPDU1 Polyclonal Antibody, HRP Conjugated

A62971 100 µg
EUR 570.55
Description: kits suitable for this type of research

MPDU1 Polyclonal Antibody, FITC Conjugated

A62972 100 µg
EUR 570.55
Description: fast delivery possible

MPDU1 Polyclonal Antibody, Biotin Conjugated

A62973 100 µg
EUR 570.55
Description: reagents widely cited

Mpdu1 ORF Vector (Rat) (pORF)

ORF070708 1.0 ug DNA
EUR 506

MPDU1 ORF Vector (Human) (pORF)

ORF006585 1.0 ug DNA
EUR 95

Mpdu1 ORF Vector (Mouse) (pORF)

ORF050411 1.0 ug DNA
EUR 506

Mpdu1 sgRNA CRISPR Lentivector set (Rat)

K6170601 3 x 1.0 ug
EUR 339

MPDU1 sgRNA CRISPR Lentivector set (Human)

K1319501 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector set (Mouse)

K4472301 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6170602 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6170603 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6170604 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1319502 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1319503 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1319504 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4472302 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4472303 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4472304 1.0 ug DNA
EUR 154

MPDU1 Protein Vector (Mouse) (pPB-C-His)

PV201642 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPB-N-His)

PV201643 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-HA)

PV201644 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-His)

PV201645 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-C-His)

PV282830 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-N-His)

PV282831 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-HA)

PV282832 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-His)

PV282833 500 ng
EUR 603

MPDU1 Protein Vector (Human) (pPB-C-His)

PV026337 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPB-N-His)

PV026338 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-HA)

PV026339 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-His)

PV026340 500 ng
EUR 329

Mpdu1 3'UTR Luciferase Stable Cell Line

TU113346 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU163346 1.0 ml Ask for price

Mpdu1 3'UTR Luciferase Stable Cell Line

TU213328 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU263328 1.0 ml Ask for price

MPDU1 3'UTR GFP Stable Cell Line

TU064467 1.0 ml
EUR 1394

MPDU1 3'UTR Luciferase Stable Cell Line

TU014467 1.0 ml
EUR 1394

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6170605 3 x 1.0 ug
EUR 376

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1319505 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4472305 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6170606 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6170607 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6170608 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1319506 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1319507 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1319508 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4472306 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4472307 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4472308 1.0 ug DNA
EUR 167

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-48T 48T
EUR 332
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-96T 96T
EUR 539
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-48T 48T
EUR 332
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-96T 96T
EUR 539
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.