SEC24C Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SEC24C Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is Unconjugated. Tested in the following application: ELISA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human Protein transport protein Sec24C, SEC24C ELISA KIT
ELI-13439h 96 Tests
EUR 824
SEC24C Polyclonal Antibody
27501-100ul 100ul
EUR 252
SEC24C Polyclonal Antibody
27501-50ul 50ul
EUR 187
SEC24C Rabbit pAb
A10797-100ul 100 ul
EUR 308
SEC24C Rabbit pAb
A10797-200ul 200 ul
EUR 459
SEC24C Rabbit pAb
A10797-20ul 20 ul
EUR 183
SEC24C Rabbit pAb
A10797-50ul 50 ul
EUR 223
SEC24C cloning plasmid
CSB-CL020952HU-10ug 10ug
EUR 1204
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3285
  • Sequence: atgaacgtcaaccagtcagttccacctgtgccaccatttgggcagccccagcccatctacccagggtatcatcagtccagctatggtgggcaatcagggtccacagcccccgccattccctatggagcctacaatggcccagtaccaggctatcagcaaacacctccccaaggta
  • Show more
Description: A cloning plasmid for the SEC24C gene.
SEC24C Rabbit pAb
A9159-100ul 100 ul
EUR 308
SEC24C Rabbit pAb
A9159-200ul 200 ul
EUR 459
SEC24C Rabbit pAb
A9159-20ul 20 ul Ask for price
SEC24C Rabbit pAb
A9159-50ul 50 ul Ask for price
SEC24C Polyclonal Antibody
A60838 100 µg
EUR 570.55
Description: reagents widely cited
anti- SEC24C antibody
FNab07682 100µg
EUR 548.75
  • Immunogen: SEC24 family, member C(S. cerevisiae)
  • Uniprot ID: P53992
  • Gene ID: 9632
  • Research Area: Metabolism
Description: Antibody raised against SEC24C
Anti-SEC24C antibody
PAab07682 100 ug
EUR 386
pDONR223-SEC24C Plasmid
PVTB00920 2 ug
EUR 356
Anti-SEC24C antibody
STJ111590 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified.
Anti-SEC24C antibody
STJ112693 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified.
Anti-SEC24C Antibody
STJ502900 100 µg
EUR 476
Polyclonal SEC24C Antibody (Center)
AMM07743G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC24C (Center). This antibody is tested and proven to work in the following applications:
EF002791 96 Tests
EUR 689
SEC24C Polyclonal Conjugated Antibody
C27501 100ul
EUR 397
SEC24C Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEC24C Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEC24C Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SEC24C shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SEC24C Antibody BIOTIN
STJ502901 100 µg
EUR 586
Anti-SEC24C Antibody FITC
STJ502902 100 µg
EUR 586
SEC24C Polyclonal Antibody, Biotin Conjugated
A60839 100 µg
EUR 570.55
Description: Ask the seller for details
SEC24C Polyclonal Antibody, FITC Conjugated
A60840 100 µg
EUR 570.55
Description: The best epigenetics products
SEC24C Polyclonal Antibody, HRP Conjugated
A60841 100 µg
EUR 570.55
Description: kits suitable for this type of research
Sec24c ORF Vector (Rat) (pORF)
ORF075968 1.0 ug DNA
EUR 506
SEC24C ORF Vector (Human) (pORF)
ORF009303 1.0 ug DNA
EUR 95
Sec24c ORF Vector (Mouse) (pORF)
ORF056859 1.0 ug DNA
EUR 506
Sec24c ORF Vector (Mouse) (pORF)
ORF056860 1.0 ug DNA
EUR 506
Sec24c sgRNA CRISPR Lentivector set (Mouse)
K4683701 3 x 1.0 ug
EUR 339
Sec24c sgRNA CRISPR Lentivector set (Rat)
K6600201 3 x 1.0 ug
EUR 339
SEC24C sgRNA CRISPR Lentivector set (Human)
K2113701 3 x 1.0 ug
EUR 339
Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4683702 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4683703 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4683704 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6600202 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6600203 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6600204 1.0 ug DNA
EUR 154
SEC24C sgRNA CRISPR Lentivector (Human) (Target 1)
K2113702 1.0 ug DNA
EUR 154
SEC24C sgRNA CRISPR Lentivector (Human) (Target 2)
K2113703 1.0 ug DNA
EUR 154
SEC24C sgRNA CRISPR Lentivector (Human) (Target 3)
K2113704 1.0 ug DNA
EUR 154
SEC24C Protein Vector (Rat) (pPB-C-His)
PV303870 500 ng
EUR 1191
SEC24C Protein Vector (Rat) (pPB-N-His)
PV303871 500 ng
EUR 1191
SEC24C Protein Vector (Rat) (pPM-C-HA)
PV303872 500 ng
EUR 1191
SEC24C Protein Vector (Rat) (pPM-C-His)
PV303873 500 ng
EUR 1191
SEC24C Protein Vector (Mouse) (pPB-C-His)
PV227434 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPB-N-His)
PV227435 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-HA)
PV227436 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-His)
PV227437 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPB-C-His)
PV227438 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPB-N-His)
PV227439 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-HA)
PV227440 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-His)
PV227441 500 ng
EUR 1065
SEC24C Protein Vector (Human) (pPB-C-His)
PV037209 500 ng
EUR 329
SEC24C Protein Vector (Human) (pPB-N-His)
PV037210 500 ng
EUR 329
SEC24C Protein Vector (Human) (pPM-C-HA)
PV037211 500 ng
EUR 329
SEC24C Protein Vector (Human) (pPM-C-His)
PV037212 500 ng
EUR 329
Sec24c 3'UTR Luciferase Stable Cell Line
TU118502 1.0 ml Ask for price
Sec24c 3'UTR GFP Stable Cell Line
TU168502 1.0 ml Ask for price
Sec24c 3'UTR Luciferase Stable Cell Line
TU220064 1.0 ml Ask for price
Sec24c 3'UTR GFP Stable Cell Line
TU270064 1.0 ml Ask for price
SEC24C 3'UTR GFP Stable Cell Line
TU072840 1.0 ml
EUR 1521
SEC24C 3'UTR Luciferase Stable Cell Line
TU022840 1.0 ml
EUR 1521
Human SEC24 Family Member C (SEC24C) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
ELISA Kit for SEC24 Family, Member C (SEC24C)
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as SEC24 Family, Member C elisa. Alternative names of the recognized antigen: SEC24-related protein C
  • Protein transport protein Sec24C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of SEC24 Family, Member C (SEC24C) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx122216-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx032305-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx032305-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx237682-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.