Sars Controls


Detectie en onderzoek naar het nieuwe Sars CoV-2 virus reagentia:

Sars/ Rat Sars ELISA Kit
ELI-41050r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SARS antibody
39139-100ul 100ul
EUR 252
SARS antibody
70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody
SARS antibody
70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS
SARS antibody
70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SARS Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
SARS Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PVT12269 2 ug
EUR 391
Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug 100ug
EUR 218
Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg 1mg
EUR 1061
Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug 500ug
EUR 663
Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug 100ug
EUR 218
Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg 1mg
EUR 1061
Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug 500ug
EUR 663
Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug 100ug
EUR 218
Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg 1mg
EUR 1061
Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug 500ug
EUR 663
Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug 100ug
EUR 218
Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg 1mg
EUR 1261
Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug 500ug
EUR 663
Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg 1mg
EUR 3954
Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug 20ug
EUR 201
Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug 5ug
EUR 155
Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug 100ug
EUR 218
Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg 1mg
EUR 1061
Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug 500ug
EUR 663
SARS Conjugated Antibody
C39139 100ul
EUR 397
SARS cloning plasmid
CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.
SARS cloning plasmid
CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.
SARS Protease Substrate
H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net
SARS Protease Substrate
H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net
anti- SARS antibody
FNab07609 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: seryl-tRNA synthetase
  • Uniprot ID: P49591
  • Gene ID: 6301
  • Research Area: Metabolism
Description: Antibody raised against SARS
SARS Spike Antibody
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SARS Nucleocapsid Antibody
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SARS Spike Antibody
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SARS Nucleocapsid Antibody
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SARS-E2 Antibody
abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
SARS-M Antibody
abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
SARS Polyclonal Antibody
A53977 100 µg
EUR 570.55
Description: The best epigenetics products
SARS Rabbit pAb
A13350-100ul 100 ul
EUR 308
SARS Rabbit pAb
A13350-200ul 200 ul
EUR 459
SARS Rabbit pAb
A13350-20ul 20 ul
EUR 183
SARS Rabbit pAb
A13350-50ul 50 ul
EUR 223
SARS Rabbit pAb
A6733-100ul 100 ul
EUR 308
SARS Rabbit pAb
A6733-200ul 200 ul
EUR 459
SARS Rabbit pAb
A6733-20ul 20 ul
EUR 183
SARS Rabbit pAb
A6733-50ul 50 ul
EUR 223
SARS Blocking Peptide
33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444
SARS Blocking Peptide
33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445
SARS Coronavirus antibody
10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody
SARS Nucleocapsid antibody
10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody
SARS Nucleocapsid antibody
10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody
SARS E2 antibody
10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody
SARS M antibody
10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody
SARS Spike Antibody
24216-100ul 100ul
EUR 390
SARS Spike Antibody
24217-100ul 100ul
EUR 390
SARS Spike Antibody
24218-100ul 100ul
EUR 390
SARS Spike Antibody
24219-100ul 100ul
EUR 390
SARS Spike Antibody
24318-100ul 100ul
EUR 390
SARS Matrix Antibody
24319-100ul 100ul
EUR 390
SARS Matrix Antibody
24320-100ul 100ul
EUR 390
SARS Envelope Antibody
24321-100ul 100ul
EUR 390
SARS Envelope Antibody
24322-100ul 100ul
EUR 390
SARS S1 [His]
DAG1861 500 ug
EUR 2529
SARS S2 [His]
DAG1862 500 ug
EUR 2529
Anti-SARS antibody
PAab07609 100 ug
EUR 386
Anti-SARS antibody
STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.
Anti-SARS antibody
STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.
Anti-SARS (1H4)
YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS
Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug
QP13420-100ug 100ug
EUR 218
Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg
QP13420-1mg 1mg
EUR 1061
Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug
QP13420-500ug 500ug
EUR 663
Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug
QP13421-100ug 100ug
EUR 218
Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg
QP13421-1mg 1mg
EUR 1061
Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug
QP13421-500ug 500ug
EUR 663
Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug
QP13422-100ug 100ug
EUR 218
Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg
QP13422-1mg 1mg
EUR 1061
Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug
QP13422-500ug 500ug
EUR 663
Polyclonal SARS Matrix Antibody
APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:
Polyclonal SARS Matrix Antibody
APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:
Rat SARS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF002719 96 Tests
EUR 689
SARS CoV E Protein
abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.
SARS CoV Nucleocapsid Protein
abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.
SARS-CoV Nucleocapsid Protein
abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.
SARS-CoV Nucleocapsid Protein
abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.
SARS-CoV Spike Protein
abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.
SARS virus Sn Antibody
abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SARS virus Sn Antibody
abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SARS virus Sm Antibody
abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SARS virus Sm Antibody
abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ACE2 (SARS Receptor) Antibody
abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ACE2 (SARS Receptor) Antibody
abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SARS N Protein Antibody
abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
SARS N Protein Antibody
abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
Human SARS shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SARS protein (His tag)
80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

Sars-CoV-2 detection

Geef een reactie

Het e-mailadres wordt niet gepubliceerd. Vereiste velden zijn gemarkeerd met *