Detectie en onderzoek naar het nieuwe Sars CoV-2 virus reagentia:

Sars/ Rat Sars ELISA Kit
ELI-41050r	Lifescience Market	96 Tests	EUR 886

SARS siRNA
20-abx904776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS antibody
39139-100ul	SAB	100ul	EUR 252

SARS antibody
70R-20086	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody
70R-1444	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody
70R-1445	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS siRNA
20-abx932473	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS Antibody
1-CSB-PA04145A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody
1-CSB-PA020709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pENTR223-SARS
PVT12269	Lifescience Market	2 ug	EUR 391

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg	EnQuireBio	1mg	EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg	EnQuireBio	1mg	EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug	EnQuireBio	20ug	EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug	EnQuireBio	5ug	EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug	EnQuireBio	500ug	EUR 663

SARS Conjugated Antibody
C39139	SAB	100ul	EUR 397

SARS cloning plasmid
CSB-CL020709HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS Protease Substrate
H-5982.0500	Bachem	0.5mg	EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000	Bachem	1.0mg	EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

anti- SARS antibody
FNab07609	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: seryl-tRNA synthetase Uniprot ID: P49591 Gene ID: 6301 Research Area: Metabolism
Description: Antibody raised against SARS

SARS Spike Antibody
20-abx137200	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1720.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1970.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS-E2 Antibody
abx016055-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS Polyclonal Antibody
A53977	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SARS Rabbit pAb
A13350-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A13350-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A13350-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A13350-50ul	Abclonal	50 ul	EUR 223

SARS Rabbit pAb
A6733-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A6733-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A6733-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A6733-50ul	Abclonal	50 ul	EUR 223

SARS Blocking Peptide
33R-7048	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS Blocking Peptide
33R-8713	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Coronavirus antibody
10C-CR9003M1	Fitzgerald	100 ug	EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS E2 antibody
10R-1976	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Spike Antibody
24216-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24217-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24218-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24219-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24318-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24319-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24320-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24321-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24322-100ul	SAB	100ul	EUR 390

SARS S1 [His]
DAG1861	Creative Diagnostics	500 ug	EUR 2529

SARS S2 [His]
DAG1862	Creative Diagnostics	500 ug	EUR 2529

Anti-SARS antibody
PAab07609	Lifescience Market	100 ug	EUR 386

Anti-SARS antibody
STJ28816	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)
YF-MA10816	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SARS

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug
QP13420-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg
QP13420-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug
QP13420-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug
QP13421-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg
QP13421-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug
QP13421-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug
QP13422-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg
QP13422-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug
QP13422-500ug	EnQuireBio	500ug	EUR 663

Polyclonal SARS Matrix Antibody
APR11178G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Polyclonal SARS Matrix Antibody
APG02976G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Rat SARS shRNA Plasmid
20-abx988123	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SARS ELISA KIT|Human
EF002719	Lifescience Market	96 Tests	EUR 689

SARS CoV E Protein
abx060650-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein
abx060652-1mg	Abbexa	1 mg	EUR 1873
Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060653-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060654-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS-CoV Spike Protein
abx060655-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SARS N Protein Antibody
abx018255-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS N Protein Antibody
abx018256-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Human SARS shRNA Plasmid
20-abx954245	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SARS protein (His tag)
80R-2099	Fitzgerald	50 ug	EUR 322
Description: Recombinant human SARS protein (His tag)