  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL27A antibody

70R-50340 100 ul
EUR 244
Description: Purified Polyclonal RPL27A antibody

RPL27A antibody

70R-33949 100 ug
EUR 327
Description: Rabbit polyclonal RPL27A antibody

RPL27A Antibody

ABD3704 100 ug
EUR 438

RPL27A Antibody

34351-100ul 100ul
EUR 252

RPL27A Antibody

34351-50ul 50ul
EUR 187


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL27A Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL27A. Recognizes RPL27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPL27A Antibody

CSB-PA941435-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL27A. Recognizes RPL27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPL27A Antibody

DF3704 200ul
EUR 304
Description: RPL27A Antibody detects endogenous levels of total RPL27A.

RPL27A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL27A. Recognizes RPL27A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000


YF-PA24607 50 ul
EUR 334
Description: Mouse polyclonal to RPL27A

RPL27A Conjugated Antibody

C34351 100ul
EUR 397

RPL27A cloning plasmid

CSB-CL020214HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 105
  • Sequence: atgactcccccgcgtcccagaccggaagaagcccggcggagaccggcctcgctcggccacttccggcaagggcggagccggccagtggtgcgcgagcgcagataa
Description: A cloning plasmid for the RPL27A gene.

RPL27A cloning plasmid

CSB-CL020214HU2-10ug 10ug
EUR 234
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 447
  • Sequence: atgccatccagactgaggaagacccggaaacttaggggccacgtgagccacggccacggccgcataggcaagcaccggaagcaccccggcggccgcggtaatgctggtggtctgcatcaccaccggatcaacttcgacaaataccacccaggctactttgggaaagttggtatgaa
  • Show more
Description: A cloning plasmid for the RPL27A gene.

anti- RPL27A antibody

FNab07427 100µg
EUR 548.75
  • Immunogen: ribosomal protein L27a
  • Uniprot ID: P46776
  • Gene ID: 6157
  • Research Area: Metabolism
Description: Antibody raised against RPL27A

RPL27A Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPL27A Blocking Peptide

DF3704-BP 1mg
EUR 195

Anti-RPL27A antibody

PAab07427 100 ug
EUR 386

pSV40- Rpl27a- m

PVT11524 2 ug
EUR 273

Mouse RPL27A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL27A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002585 96 Tests
EUR 689

Human RPL27A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL27A Recombinant Protein (Human)

RP026935 100 ug Ask for price

RPL27A Recombinant Protein (Human)

RP026938 100 ug Ask for price

RPL27A Recombinant Protein (Rat)

RP226652 100 ug Ask for price

Ribosomal Protein L27A (RPL27A) Antibody

abx038358-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

abx025995-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

abx025995-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

abx332254-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L27A (RPL27A) Antibody

abx237427-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL27A ORF Vector (Human) (pORF)

ORF008979 1.0 ug DNA
EUR 95

RPL27A ORF Vector (Human) (pORF)

ORF008980 1.0 ug DNA
EUR 95

Rpl27a ORF Vector (Mouse) (pORF)

ORF056340 1.0 ug DNA
EUR 506

Rpl27a ORF Vector (Rat) (pORF)

ORF075552 1.0 ug DNA
EUR 506

Anti-RPL27A/Ribosomal Protein L27A Antibody

A07864 100ul
EUR 397
Description: Rabbit Polyclonal RPL27A/Ribosomal Protein L27A Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

RPL27A sgRNA CRISPR Lentivector set (Human)

K1952501 3 x 1.0 ug
EUR 339

Rpl27a sgRNA CRISPR Lentivector set (Rat)

K6271801 3 x 1.0 ug
EUR 339

Rpl27a sgRNA CRISPR Lentivector set (Mouse)

K4976701 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L27A (RPL27A) ELISA Kit

abx382912-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPL27A sgRNA CRISPR Lentivector (Human) (Target 1)

K1952502 1.0 ug DNA
EUR 154

RPL27A sgRNA CRISPR Lentivector (Human) (Target 2)

K1952503 1.0 ug DNA
EUR 154

RPL27A sgRNA CRISPR Lentivector (Human) (Target 3)

K1952504 1.0 ug DNA
EUR 154

Rpl27a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6271802 1.0 ug DNA
EUR 154

Rpl27a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6271803 1.0 ug DNA
EUR 154

Rpl27a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6271804 1.0 ug DNA
EUR 154

Rpl27a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4976702 1.0 ug DNA
EUR 154

Rpl27a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4976703 1.0 ug DNA
EUR 154

Rpl27a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4976704 1.0 ug DNA
EUR 154

RPL27A Protein Vector (Human) (pPB-C-His)

PV035913 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPB-N-His)

PV035914 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPM-C-HA)

PV035915 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPM-C-His)

PV035916 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPB-C-His)

PV035917 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPB-N-His)

PV035918 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPM-C-HA)

PV035919 500 ng
EUR 329

RPL27A Protein Vector (Human) (pPM-C-His)

PV035920 500 ng
EUR 329

RPL27A Protein Vector (Rat) (pPB-C-His)

PV302206 500 ng
EUR 603

RPL27A Protein Vector (Rat) (pPB-N-His)

PV302207 500 ng
EUR 603

RPL27A Protein Vector (Rat) (pPM-C-HA)

PV302208 500 ng
EUR 603

RPL27A Protein Vector (Rat) (pPM-C-His)

PV302209 500 ng
EUR 603

RPL27A Protein Vector (Mouse) (pPB-C-His)

PV225358 500 ng
EUR 603

RPL27A Protein Vector (Mouse) (pPB-N-His)

PV225359 500 ng
EUR 603

RPL27A Protein Vector (Mouse) (pPM-C-HA)

PV225360 500 ng
EUR 603

RPL27A Protein Vector (Mouse) (pPM-C-His)

PV225361 500 ng
EUR 603

RPL27A 3'UTR Luciferase Stable Cell Line

TU021204 1.0 ml
EUR 2333

RPL27A 3'UTR GFP Stable Cell Line

TU071204 1.0 ml
EUR 2333

Rpl27a 3'UTR Luciferase Stable Cell Line

TU219633 1.0 ml Ask for price

Rpl27a 3'UTR GFP Stable Cell Line

TU269633 1.0 ml Ask for price

Rat 60S ribosomal protein L27a(RPL27A) ELISA kit

E02R0448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L27a(RPL27A) ELISA kit

E02R0448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L27a(RPL27A) ELISA kit

E02R0448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L27a(RPL27A) ELISA kit

E03R0448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L27a(RPL27A) ELISA kit

E03R0448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L27a(RPL27A) ELISA kit

E03R0448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L27a(RPL27A) ELISA kit

E04R0448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L27a(RPL27A) ELISA kit

E04R0448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L27a(RPL27A) ELISA kit

E04R0448-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L27a(RPL27A) ELISA kit

E01R0448-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L27a(RPL27A) ELISA kit

E01R0448-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L27a(RPL27A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.