Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
DLR-RIPK1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
DLR-RIPK1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
DLR-RIPK1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RD-RIPK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RD-RIPK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RD-RIPK1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RD-RIPK1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RDR-RIPK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RDR-RIPK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RDR-RIPK1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit
RDR-RIPK1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

RIPK1 Antibody
AF7588	Affbiotech	200ul	EUR 376
Description: RIPK1 Antibody detects endogenous levels of RIPK1.

RIPk1 Antibody
AF7877	Affbiotech	200ul	EUR 376
Description: RIP Antibody detects endogenous levels of RIP.

RIPK1 siRNA
20-abx931562	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RIPK1 siRNA
20-abx931563	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RIPK1 antibody
70R-21675	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RIPK1 antibody

RIPK1 Antibody
ABD2642	Lifescience Market	100 ug	EUR 438

RIPK1 Antibody
ABD8234	Lifescience Market	100 ug	EUR 438

RIPK1 Antibody
44878-100ul	SAB	100ul	EUR 252

RIPK1 Antibody
44878-50ul	SAB	50ul	EUR 187

RIPK1 Antibody
24965-100ul	SAB	100ul	EUR 390

RIPK1 antibody
70R-10453	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RIPK1 antibody

RIPK1 Antibody
DF8234	Affbiotech	200ul	EUR 304
Description: RIPK1 Antibody detects endogenous levels of total RIPK1.

RIPK1 Antibody
DF2642	Affbiotech	200ul	EUR 304
Description: RIPK1 antibody detects endogenous levels of total RIPK1.

RIPK1 Antibody
1-CSB-PA618785LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:200-1:500

Ripk1 Antibody
1-CSB-PA720181LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse, Human. This antibody is Unconjugated. Tested in the following application: ELISA, IP; Recommended dilution: IP:1:200-1:2000

RIPK1 Antibody
1-CSB-PA019735GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK1 Conjugated Antibody
C44878	SAB	100ul	EUR 397

Polyclonal RIPK1 Antibody
APR06567G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 . This antibody is tested and proven to work in the following applications:

RIPK1 Blocking Peptide
AF7588-BP	Affbiotech	1mg	EUR 195

RIPk1 Blocking Peptide
AF7877-BP	Affbiotech	1mg	EUR 195

RIPK1 cloning plasmid
CSB-CL618785HU-10ug	Cusabio	10ug	EUR 674
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2016 Sequence: atgcaaccagacatgtccttgaatgtcattaagatgaaatccagtgacttcctggagagtgcagaactggacagcggaggcttcgggaaggtgtctctgtgtttccacagaacccagggactcatgatcatgaaaacagtgtacaaggggcccaactgcattgagcacaacgagg Show more
Description: A cloning plasmid for the RIPK1 gene.

RIPK1-IN-4
HY-18901	MedChemExpress	25mg	EUR 1187

RIPK1-IN-7
HY-119933	MedChemExpress	100mg	EUR 3838

RIPK1 Polyclonal Antibody
ES10796-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK1 Polyclonal Antibody
ES10796-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK1 Polyclonal Antibody
ABP60179-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1 Polyclonal Antibody
ABP60179-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1 Polyclonal Antibody
ABP60179-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1-Specific Antibody
abx237313-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RIPK1 Rabbit pAb
A7414-100ul	Abclonal	100 ul	EUR 308

RIPK1 Rabbit pAb
A7414-200ul	Abclonal	200 ul	EUR 459

RIPK1 Rabbit pAb
A7414-20ul	Abclonal	20 ul	EUR 183

RIPK1 Rabbit pAb
A7414-50ul	Abclonal	50 ul	EUR 223

RIPK1 Blocking Peptide
33R-8158	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK1 antibody, catalog no. 70R-10453

RIPK1 Blocking Peptide
DF8234-BP	Affbiotech	1mg	EUR 195

RIPK1 Blocking Peptide
DF2642-BP	Affbiotech	1mg	EUR 195

Anti-RIPK1 Antibody
STJ502798	St John's Laboratory	100 µg	EUR 476

Anti-RIPK1 antibody
STJ29550	St John's Laboratory	100 µl	EUR 277

Anti-RIPK1 antibody
STJ191954	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RIPK1

Phospho-RIPK1 (Ser166) Antibody
AF2398	Affbiotech	200ul	EUR 304
Description: Phospho-RIP (Ser166) Antibody detects endogenous levels of RIP.

Phospho-RIPK1(Tyr384) Antibody
AF7088	Affbiotech	200ul	EUR 376
Description: Phospho-RIPK1(Tyr284) Antibody detects endogenous levels of RIPK1 only when phosphorylated at Tyr284.

Phospho-RIPk1 (Ser161) Antibody
AF7377	Affbiotech	200ul	EUR 376
Description: Phospho-RIP (Ser161) Antibody detects endogenous levels of RIP only when phosphorylated at Ser161.

RIPK1 ELISA KIT|Human
EF002481	Lifescience Market	96 Tests	EUR 689

anti- RIPK1-Specific antibody
FNab07313	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IP: 1:200-1:1000 IHC: 1:100-1:400 IF: 1:10-1:100 Immunogen: receptor(TNFRSF)-interacting serine-threonine kinase 1 Uniprot ID: Q13546 Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK1-Specific

Human RIPK1 shRNA Plasmid
20-abx955755	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RIPK1 (Phospho-Tyr284) Antibody
12953-100ul	SAB	100ul	EUR 252

RIPK1 (Phospho-Tyr284) Antibody
12953-50ul	SAB	50ul	EUR 187

Mouse RIPK1 shRNA Plasmid
20-abx972462	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RIPK1 Antibody, HRP conjugated
1-CSB-PA618785LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK1 Antibody, FITC conjugated
1-CSB-PA618785LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK1 Antibody, Biotin conjugated
1-CSB-PA618785LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ripk1 Antibody, HRP conjugated
1-CSB-PA720181LB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ripk1 Antibody, FITC conjugated
1-CSB-PA720181LC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ripk1 Antibody, Biotin conjugated
1-CSB-PA720181LD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP/RIPK1 Antibody
PB9116	BosterBio	100ug/vial	EUR 294

Anti-RIPK1-Specific antibody
PAab07313	Lifescience Market	100 ug	EUR 386

Anti-RIP/RIPK1 Antibody
PA2051	BosterBio	100ug/vial	EUR 294

Anti-RIPK1 Antibody (Biotin)
STJ502799	St John's Laboratory	100 µg	EUR 586

Anti-RIPK1 Antibody (FITC)
STJ502800	St John's Laboratory	100 µg	EUR 586

Polyclonal RIPK1 antibody - middle region
APR01895G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 - middle region. This antibody is tested and proven to work in the following applications:

Phospho-RIPK1 (Ser166) Blocking Peptide
AF2398-BP	Affbiotech	1mg	EUR 195

Phospho-RIPK1-S166 Rabbit pAb
AP1115-100ul	Abclonal	100 ul	EUR 384

Phospho-RIPK1-S166 Rabbit pAb
AP1115-200ul	Abclonal	200 ul	EUR 554

Phospho-RIPK1-S166 Rabbit pAb
AP1115-20ul	Abclonal	20 ul	EUR 183

Phospho-RIPK1-S166 Rabbit pAb
AP1115-50ul	Abclonal	50 ul	EUR 265

Phospho-RIPK1(Tyr384) Blocking Peptide
AF7088-BP	Affbiotech	1mg	EUR 195

Phospho-RIPk1 (Ser161) Blocking Peptide
AF7377-BP	Affbiotech	1mg	EUR 195

RIPK1 ORF Vector (Human) (pORF)
ORF028956	ABM	1.0 ug DNA	EUR 95

h RIPK1 inducible lentiviral particles
LVP786	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1 ), [alternative names: RIP; RIP1]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003804.3. It also contains a RFP-Blasticidin dual selection marker.

Ripk1 ORF Vector (Mouse) (pORF)
ORF056094	ABM	1.0 ug DNA	EUR 506

Ripk1 ORF Vector (Rat) (pORF)
ORF075392	ABM	1.0 ug DNA	EUR 506

Anti-Phospho-RIPK1-S166 antibody
STJ11101149	St John's Laboratory	100 µl	EUR 393

RIPK1 ELISA Kit (Human) (OKCD00436)
OKCD00436	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Serine-threonine kinase which transduces inflammatory and cell-death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Phosphorylates DAB2IP at 'Ser-728' in a TNF-alpha-dependent manner, and thereby activates the MAP3K5-JNK apoptotic cascade. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necrosis-inducing complex.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

RIPK1 ELISA Kit (Rat) (OKCD00437)
OKCD00437	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL