RIPK1

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Hu-96T 96T
EUR 673
  • Should the Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Ra-48T 48T
EUR 549
  • Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

DLR-RIPK1-Ra-96T 96T
EUR 718
  • Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Hu-48Tests 48 Tests
EUR 521

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Hu-96Tests 96 Tests
EUR 723

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Ra-48Tests 48 Tests
EUR 557

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RD-RIPK1-Ra-96Tests 96 Tests
EUR 775

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Hu-48Tests 48 Tests
EUR 544

Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Hu-96Tests 96 Tests
EUR 756

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Ra-48Tests 48 Tests
EUR 583

Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit

RDR-RIPK1-Ra-96Tests 96 Tests
EUR 811

RIPK1 Antibody

AF7588 200ul
EUR 376
Description: RIPK1 Antibody detects endogenous levels of RIPK1.

RIPk1 Antibody

AF7877 200ul
EUR 376
Description: RIP Antibody detects endogenous levels of RIP.

RIPK1 siRNA

20-abx931562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK1 siRNA

20-abx931563
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK1 antibody

70R-21675 50 ul
EUR 435
Description: Rabbit polyclonal RIPK1 antibody

RIPK1 Antibody

ABD2642 100 ug
EUR 438

RIPK1 Antibody

ABD8234 100 ug
EUR 438

RIPK1 Antibody

44878-100ul 100ul
EUR 252

RIPK1 Antibody

44878-50ul 50ul
EUR 187

RIPK1 Antibody

24965-100ul 100ul
EUR 390

RIPK1 antibody

70R-10453 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RIPK1 antibody

RIPK1 Antibody

DF8234 200ul
EUR 304
Description: RIPK1 Antibody detects endogenous levels of total RIPK1.

RIPK1 Antibody

DF2642 200ul
EUR 304
Description: RIPK1 antibody detects endogenous levels of total RIPK1.

RIPK1 Antibody

1-CSB-PA618785LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:200-1:500

Ripk1 Antibody

1-CSB-PA720181LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse, Human. This antibody is Unconjugated. Tested in the following application: ELISA, IP; Recommended dilution: IP:1:200-1:2000

RIPK1 Antibody

1-CSB-PA019735GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK1 Conjugated Antibody

C44878 100ul
EUR 397

Polyclonal RIPK1 Antibody

APR06567G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 . This antibody is tested and proven to work in the following applications:

RIPK1 Blocking Peptide

AF7588-BP 1mg
EUR 195

RIPk1 Blocking Peptide

AF7877-BP 1mg
EUR 195

RIPK1 cloning plasmid

CSB-CL618785HU-10ug 10ug
EUR 674
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2016
  • Sequence: atgcaaccagacatgtccttgaatgtcattaagatgaaatccagtgacttcctggagagtgcagaactggacagcggaggcttcgggaaggtgtctctgtgtttccacagaacccagggactcatgatcatgaaaacagtgtacaaggggcccaactgcattgagcacaacgagg
  • Show more
Description: A cloning plasmid for the RIPK1 gene.

RIPK1-IN-4

HY-18901 25mg
EUR 1187

RIPK1-IN-7

HY-119933 100mg
EUR 3838

RIPK1 Polyclonal Antibody

ES10796-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK1 Polyclonal Antibody

ES10796-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK1 Polyclonal Antibody

ABP60179-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1 Polyclonal Antibody

ABP60179-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1 Polyclonal Antibody

ABP60179-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein

RIPK1-Specific Antibody

abx237313-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RIPK1 Rabbit pAb

A7414-100ul 100 ul
EUR 308

RIPK1 Rabbit pAb

A7414-200ul 200 ul
EUR 459

RIPK1 Rabbit pAb

A7414-20ul 20 ul
EUR 183

RIPK1 Rabbit pAb

A7414-50ul 50 ul
EUR 223

RIPK1 Blocking Peptide

33R-8158 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK1 antibody, catalog no. 70R-10453

RIPK1 Blocking Peptide

DF8234-BP 1mg
EUR 195

RIPK1 Blocking Peptide

DF2642-BP 1mg
EUR 195

Anti-RIPK1 Antibody

STJ502798 100 µg
EUR 476

Anti-RIPK1 antibody

STJ29550 100 µl
EUR 277

Anti-RIPK1 antibody

STJ191954 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RIPK1

Phospho-RIPK1 (Ser166) Antibody

AF2398 200ul
EUR 304
Description: Phospho-RIP (Ser166) Antibody detects endogenous levels of RIP.

Phospho-RIPK1(Tyr384) Antibody

AF7088 200ul
EUR 376
Description: Phospho-RIPK1(Tyr284) Antibody detects endogenous levels of RIPK1 only when phosphorylated at Tyr284.

Phospho-RIPk1 (Ser161) Antibody

AF7377 200ul
EUR 376
Description: Phospho-RIP (Ser161) Antibody detects endogenous levels of RIP only when phosphorylated at Ser161.

RIPK1 ELISA KIT|Human

EF002481 96 Tests
EUR 689

anti- RIPK1-Specific antibody

FNab07313 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: receptor(TNFRSF)-interacting serine-threonine kinase 1
  • Uniprot ID: Q13546
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK1-Specific

Human RIPK1 shRNA Plasmid

20-abx955755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RIPK1 (Phospho-Tyr284) Antibody

12953-100ul 100ul
EUR 252

RIPK1 (Phospho-Tyr284) Antibody

12953-50ul 50ul
EUR 187

Mouse RIPK1 shRNA Plasmid

20-abx972462
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RIPK1 Antibody, HRP conjugated

1-CSB-PA618785LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK1 Antibody, FITC conjugated

1-CSB-PA618785LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK1 Antibody, Biotin conjugated

1-CSB-PA618785LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ripk1 Antibody, HRP conjugated

1-CSB-PA720181LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ripk1 Antibody, FITC conjugated

1-CSB-PA720181LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ripk1 Antibody, Biotin conjugated

1-CSB-PA720181LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP/RIPK1 Antibody

PB9116 100ug/vial
EUR 294

Anti-RIPK1-Specific antibody

PAab07313 100 ug
EUR 386

Anti-RIP/RIPK1 Antibody

PA2051 100ug/vial
EUR 294

Anti-RIPK1 Antibody (Biotin)

STJ502799 100 µg
EUR 586

Anti-RIPK1 Antibody (FITC)

STJ502800 100 µg
EUR 586

Polyclonal RIPK1 antibody - middle region

APR01895G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 - middle region. This antibody is tested and proven to work in the following applications:

Phospho-RIPK1 (Ser166) Blocking Peptide

AF2398-BP 1mg
EUR 195

Phospho-RIPK1-S166 Rabbit pAb

AP1115-100ul 100 ul
EUR 384

Phospho-RIPK1-S166 Rabbit pAb

AP1115-200ul 200 ul
EUR 554

Phospho-RIPK1-S166 Rabbit pAb

AP1115-20ul 20 ul
EUR 183

Phospho-RIPK1-S166 Rabbit pAb

AP1115-50ul 50 ul
EUR 265

Phospho-RIPK1(Tyr384) Blocking Peptide

AF7088-BP 1mg
EUR 195

Phospho-RIPk1 (Ser161) Blocking Peptide

AF7377-BP 1mg
EUR 195

RIPK1 ORF Vector (Human) (pORF)

ORF028956 1.0 ug DNA
EUR 95

h RIPK1 inducible lentiviral particles

LVP786 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1 ), [alternative names: RIP; RIP1]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003804.3. It also contains a RFP-Blasticidin dual selection marker.

Ripk1 ORF Vector (Mouse) (pORF)

ORF056094 1.0 ug DNA
EUR 506

Ripk1 ORF Vector (Rat) (pORF)

ORF075392 1.0 ug DNA
EUR 506

Anti-Phospho-RIPK1-S166 antibody

STJ11101149 100 µl
EUR 393

RIPK1 ELISA Kit (Human) (OKCD00436)

OKCD00436 96 Wells
EUR 831
Description: Description of target: Serine-threonine kinase which transduces inflammatory and cell-death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Phosphorylates DAB2IP at 'Ser-728' in a TNF-alpha-dependent manner, and thereby activates the MAP3K5-JNK apoptotic cascade. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necrosis-inducing complex.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

RIPK1 ELISA Kit (Rat) (OKCD00437)

OKCD00437 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL