RGS9

RGS9 siRNA

20-abx931429
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS9 siRNA

20-abx931430
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS9 antibody

70R-5843 50 ug
EUR 467
Description: Rabbit polyclonal RGS9 antibody raised against the middle region of RGS9

RGS9 Antibody

ABD7979 100 ug
EUR 438

RGS9 Antibody

45191-100ul 100ul
EUR 252

RGS9 Antibody

45191-50ul 50ul
EUR 187

RGS9 antibody

70R-19880 50 ul
EUR 435
Description: Rabbit polyclonal RGS9 antibody

RGS9 antibody

70R-1649 100 ug
EUR 377
Description: Rabbit polyclonal RGS9 antibody raised against the N terminal of RGS9

RGS9 Antibody

DF7979 200ul
EUR 304
Description: RGS9 Antibody detects endogenous levels of total RGS9.

RGS9 Antibody

1-CSB-PA019662ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RGS9. Recognizes RGS9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RGS9 Antibody

1-CSB-PA019662GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RGS9. Recognizes RGS9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RGS9 Conjugated Antibody

C45191 100ul
EUR 397

RGS9 cloning plasmid

CSB-CL019662HU-10ug 10ug
EUR 485
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atgtattaccaacaggccttgatgaggtccacagtgaagtcttctgtgtccctgggagggattgtgaaatacagtgagcagttctcatccaacgatgccatcatgtcaggctgcctccccagcaacccctggatcaccgatgacacccagttctgggacttaaatgccaaattgg
  • Show more
Description: A cloning plasmid for the RGS9 gene.

anti- RGS9 antibody

FNab07274 100µg
EUR 548.75
  • Immunogen: regulator of G-protein signaling 9
  • Uniprot ID: O75916
  • Gene ID: 8787
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against RGS9

RGS9 Rabbit pAb

A9326-100ul 100 ul
EUR 308

RGS9 Rabbit pAb

A9326-200ul 200 ul
EUR 459

RGS9 Rabbit pAb

A9326-20ul 20 ul
EUR 183

RGS9 Rabbit pAb

A9326-50ul 50 ul
EUR 223

RGS9 Blocking Peptide

33R-5105 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS9 antibody, catalog no. 70R-5843

RGS9 Blocking Peptide

33R-6633 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS9 antibody, catalog no. 70R-1649

RGS9 Blocking Peptide

DF7979-BP 1mg
EUR 195

Anti-RGS9 antibody

PAab07274 100 ug
EUR 386

Anti-RGS9 Antibody

PA2241 100ug/vial
EUR 294

Anti-RGS9 antibody

STJ111658 100 µl
EUR 277
Description: This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.

Rat RGS9 shRNA Plasmid

20-abx985530
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS9 ELISA KIT|Human

EF002443 96 Tests
EUR 689

Human RGS9 shRNA Plasmid

20-abx955788
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RGS9 shRNA Plasmid

20-abx972455
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS9 Recombinant Protein (Human)

RP042853 100 ug Ask for price

RGS9 Recombinant Protein (Rat)

RP225974 100 ug Ask for price

RGS9 Recombinant Protein (Mouse)

RP167936 100 ug Ask for price

RGS9 Recombinant Protein (Mouse)

RP167939 100 ug Ask for price

Polyclonal RGS9 Antibody (N-term)

AMM07602G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS9 (N-term). This antibody is tested and proven to work in the following applications:

Rgs9 ORF Vector (Mouse) (pORF)

ORF055980 1.0 ug DNA
EUR 506

Rgs9 ORF Vector (Mouse) (pORF)

ORF055981 1.0 ug DNA
EUR 506

Rgs9 ORF Vector (Rat) (pORF)

ORF075326 1.0 ug DNA
EUR 506

RGS9 ORF Vector (Human) (pORF)

ORF014285 1.0 ug DNA
EUR 354

RGS9 ELISA Kit (Human) (OKCD08515)

OKCD08515 96 Wells
EUR 975
Description: Description of target: RGS9 is a member of the RGS family of signaling proteins that suppress the activity of G proteins by promoting their deactivation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

RGS9 ELISA Kit (Mouse) (OKCD08516)

OKCD08516 96 Wells
EUR 1001
Description: Description of target: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G(t)-alpha. Involved in phototransduction; key element in the recovery phase of visual transduction. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL

Rgs9 ELISA Kit (Mouse) (OKEH04785)

OKEH04785 96 Wells
EUR 662
Description: Description of target: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G(t)-alpha. Involved in phototransduction; key element in the recovery phase of visual transduction.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL

Rgs9 ELISA Kit (Rat) (OKEH04786)

OKEH04786 96 Wells
EUR 662
Description: Description of target: Splice variant Rgs9l may act as a GTPase activating protein; inhibits dopamine D2 receptor induced G protein-coupled inward rectifier K+ channel current.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL

RGS9 ELISA Kit (Human) (OKEH05240)

OKEH05240 96 Wells
EUR 662
Description: Description of target: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G(t)-alpha. Involved in phototransduction; key element in the recovery phase of visual transduction.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.414 ng/mL

Polyclonal RGS9 antibody - N-terminal region

AMM07603G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS9 - N-terminal region. This antibody is tested and proven to work in the following applications:

RGS9 sgRNA CRISPR Lentivector set (Human)

K1817501 3 x 1.0 ug
EUR 339

Rgs9 sgRNA CRISPR Lentivector set (Mouse)

K3932101 3 x 1.0 ug
EUR 339

Rgs9 sgRNA CRISPR Lentivector set (Rat)

K6792301 3 x 1.0 ug
EUR 339

RGS9 sgRNA CRISPR Lentivector (Human) (Target 1)

K1817502 1.0 ug DNA
EUR 154

RGS9 sgRNA CRISPR Lentivector (Human) (Target 2)

K1817503 1.0 ug DNA
EUR 154

RGS9 sgRNA CRISPR Lentivector (Human) (Target 3)

K1817504 1.0 ug DNA
EUR 154

Rgs9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3932102 1.0 ug DNA
EUR 154

Rgs9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3932103 1.0 ug DNA
EUR 154

Rgs9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3932104 1.0 ug DNA
EUR 154

Rgs9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6792302 1.0 ug DNA
EUR 154

Rgs9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6792303 1.0 ug DNA
EUR 154

Rgs9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6792304 1.0 ug DNA
EUR 154

RGS9 Protein Vector (Human) (pPB-C-His)

PV057137 500 ng
EUR 481

RGS9 Protein Vector (Human) (pPB-N-His)

PV057138 500 ng
EUR 481

RGS9 Protein Vector (Human) (pPM-C-HA)

PV057139 500 ng
EUR 481

RGS9 Protein Vector (Human) (pPM-C-His)

PV057140 500 ng
EUR 481

RGS9 Protein Vector (Rat) (pPB-C-His)

PV301302 500 ng
EUR 1166

RGS9 Protein Vector (Rat) (pPB-N-His)

PV301303 500 ng
EUR 1166

RGS9 Protein Vector (Rat) (pPM-C-HA)

PV301304 500 ng
EUR 1166

RGS9 Protein Vector (Rat) (pPM-C-His)

PV301305 500 ng
EUR 1166

RGS9 Protein Vector (Mouse) (pPB-C-His)

PV223918 500 ng
EUR 603

RGS9 Protein Vector (Mouse) (pPB-N-His)

PV223919 500 ng
EUR 603

RGS9 Protein Vector (Mouse) (pPM-C-HA)

PV223920 500 ng
EUR 603

RGS9 Protein Vector (Mouse) (pPM-C-His)

PV223921 500 ng
EUR 603

RGS9 Protein Vector (Mouse) (pPB-C-His)

PV223922 500 ng
EUR 1065

RGS9 Protein Vector (Mouse) (pPB-N-His)

PV223923 500 ng
EUR 1065

RGS9 Protein Vector (Mouse) (pPM-C-HA)

PV223924 500 ng
EUR 1065

RGS9 Protein Vector (Mouse) (pPM-C-His)

PV223925 500 ng
EUR 1065

Rgs9 3'UTR GFP Stable Cell Line

TU167809 1.0 ml Ask for price

RGS9 3'UTR Luciferase Stable Cell Line

TU019845 1.0 ml
EUR 1394

Rgs9 3'UTR Luciferase Stable Cell Line

TU117809 1.0 ml Ask for price

RGS9 3'UTR GFP Stable Cell Line

TU069845 1.0 ml
EUR 1394

Rgs9 3'UTR Luciferase Stable Cell Line

TU219384 1.0 ml Ask for price

Rgs9 3'UTR GFP Stable Cell Line

TU269384 1.0 ml Ask for price

Regulator of G-Protein Signaling 9 (RGS9) Antibody

20-abx124009
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 9 (RGS9) Antibody

20-abx131446
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Regulator of G Protein Signaling 9 (RGS9) Antibody

20-abx131447
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Regulator of G-Protein Signaling 9 (RGS9) Antibody

abx027901-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Regulator of G-Protein Signaling 9 (RGS9) Antibody

abx027901-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Regulator of G-Protein Signaling 9 (RGS9) Antibody

20-abx321185
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator of G-Protein Signaling 9 (RGS9) Antibody

20-abx218282
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Regulator of G-Protein Signaling 9 (RGS9) Antibody

abx237274-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.