RGS11

369  

RGS11 Antibody
40074-100ul 100ul
EUR 252

RGS11 Antibody
1-CSB-PA937012
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS11. Recognizes RGS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

RGS11 Antibody
1-CSB-PA521847
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS11. Recognizes RGS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

RGS11 antibody
70R-5810 50 ug
EUR 467
Description: Rabbit polyclonal RGS11 antibody raised against the middle region of RGS11

RGS11 siRNA
20-abx931389
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RGS11
YF-PA15859 50 ul
EUR 363
Description: Mouse polyclonal to RGS11

RGS11 Blocking Peptide
33R-5382 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS11 antibody, catalog no. 70R-5810

RGS11 Conjugated Antibody
C40074 100ul
EUR 397

RGS11 cloning plasmid
CSB-CL019643HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1404
  • Sequence: ATGGCCGCCGGCCCCGCGCCGCCCCCCGGCCGCCCCCGGGCGCAGATGCCGCATCTGAGGAAGATGGAGCGGGTGGTCGTGAGCATGCAGGACCCCGACCAGGGCGTGAAGATGCGGAGCCAGCGCCTGCTGGTCACCGTCATTCCCCACGCGGTGACAGGCAGCGACGTCGTGC
  • Show more
Description: A cloning plasmid for the RGS11 gene.

RGS11 Rabbit pAb
A9748-100ul 100 ul
EUR 308

RGS11 Rabbit pAb
A9748-200ul 200 ul
EUR 459

RGS11 Rabbit pAb
A9748-20ul 20 ul Ask for price

RGS11 Rabbit pAb
A9748-50ul 50 ul Ask for price

anti- RGS11 antibody
FNab07265 100µg
EUR 505.25
  • Immunogen: regulator of G-protein signaling 11
  • Uniprot ID: O94810
  • Gene ID: 8786
  • Research Area: Signal Transduction
Description: Antibody raised against RGS11

Anti-RGS11 antibody
PAab07265 100 ug
EUR 355

Anti-RGS11 antibody
STJ111814 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified.

Polyclonal RGS11 Antibody (Center)
AMM07583G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS11 (Center). This antibody is tested and proven to work in the following applications:

RGS11 ELISA KIT|Human
EF002434 96 Tests
EUR 689

Human RGS11 shRNA Plasmid
20-abx955787
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS11 Recombinant Protein (Human)
RP042844 100 ug Ask for price

RGS11 Recombinant Protein (Mouse)
RP167864 100 ug Ask for price

RGS11 Recombinant Protein (Rat)
RP225929 100 ug Ask for price

Rgs11 ORF Vector (Rat) (pORF)
ORF075311 1.0 ug DNA
EUR 506

RGS11 ORF Vector (Human) (pORF)
ORF014282 1.0 ug DNA
EUR 354

Rgs11 ORF Vector (Mouse) (pORF)
ORF055956 1.0 ug DNA
EUR 506

Rgs11 sgRNA CRISPR Lentivector set (Rat)
K6933701 3 x 1.0 ug
EUR 339

RGS11 sgRNA CRISPR Lentivector set (Human)
K1817801 3 x 1.0 ug
EUR 339

Rgs11 sgRNA CRISPR Lentivector set (Mouse)
K3530901 3 x 1.0 ug
EUR 339

Rgs11 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6933702 1.0 ug DNA
EUR 154

Rgs11 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6933703 1.0 ug DNA
EUR 154

Rgs11 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6933704 1.0 ug DNA
EUR 154

RGS11 sgRNA CRISPR Lentivector (Human) (Target 1)
K1817802 1.0 ug DNA
EUR 154

RGS11 sgRNA CRISPR Lentivector (Human) (Target 2)
K1817803 1.0 ug DNA
EUR 154

RGS11 sgRNA CRISPR Lentivector (Human) (Target 3)
K1817804 1.0 ug DNA
EUR 154

Rgs11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3530902 1.0 ug DNA
EUR 154

Rgs11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3530903 1.0 ug DNA
EUR 154

Rgs11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3530904 1.0 ug DNA
EUR 154

RGS11 Protein Vector (Rat) (pPB-C-His)
PV301242 500 ng
EUR 603

RGS11 Protein Vector (Rat) (pPB-N-His)
PV301243 500 ng
EUR 603

RGS11 Protein Vector (Rat) (pPM-C-HA)
PV301244 500 ng
EUR 603

RGS11 Protein Vector (Rat) (pPM-C-His)
PV301245 500 ng
EUR 603

RGS11 Protein Vector (Human) (pPB-C-His)
PV057125 500 ng
EUR 481

RGS11 Protein Vector (Human) (pPB-N-His)
PV057126 500 ng
EUR 481

RGS11 Protein Vector (Human) (pPM-C-HA)
PV057127 500 ng
EUR 481

RGS11 Protein Vector (Human) (pPM-C-His)
PV057128 500 ng
EUR 481

RGS11 Protein Vector (Mouse) (pPB-C-His)
PV223822 500 ng
EUR 603

RGS11 Protein Vector (Mouse) (pPB-N-His)
PV223823 500 ng
EUR 603

RGS11 Protein Vector (Mouse) (pPM-C-HA)
PV223824 500 ng
EUR 603

RGS11 Protein Vector (Mouse) (pPM-C-His)
PV223825 500 ng
EUR 603

Rgs11 3'UTR Luciferase Stable Cell Line
TU117790 1.0 ml Ask for price

Rgs11 3'UTR GFP Stable Cell Line
TU167790 1.0 ml Ask for price

Rgs11 3'UTR Luciferase Stable Cell Line
TU219367 1.0 ml Ask for price

Rgs11 3'UTR GFP Stable Cell Line
TU269367 1.0 ml Ask for price

RGS11 3'UTR GFP Stable Cell Line
TU069848 1.0 ml
EUR 2333

RGS11 3'UTR Luciferase Stable Cell Line
TU019848 1.0 ml
EUR 2333

Regulator of G Protein Signaling 11 (RGS11) Antibody
abx122966-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 11 (RGS11) Antibody
20-abx124446
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 11 (RGS11) Antibody
abx029227-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 11 (RGS11) Antibody
abx029227-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 11 (RGS11) Antibody
20-abx339111
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 11 (RGS11) Antibody
20-abx339112
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 11 (RGS11) Antibody
abx237265-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RGS11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV659365 1.0 ug DNA
EUR 682

RGS11 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV659369 1.0 ug DNA
EUR 682

RGS11 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV659370 1.0 ug DNA
EUR 682

Mouse Regulator of G- protein signaling 11, Rgs11 ELISA KIT
ELI-14406m 96 Tests
EUR 865

Human Regulator of G- protein signaling 11, RGS11 ELISA KIT
ELI-30268h 96 Tests
EUR 824

Human Regulator Of G Protein Signaling 11 (RGS11) ELISA Kit
abx382788-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6933705 3 x 1.0 ug
EUR 376

RGS11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1817805 3 x 1.0 ug
EUR 376

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3530905 3 x 1.0 ug
EUR 376

RGS11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV659366 1.0 ug DNA
EUR 682

RGS11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV659367 1.0 ug DNA
EUR 740

RGS11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV659368 1.0 ug DNA
EUR 740

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6933706 1.0 ug DNA
EUR 167

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6933707 1.0 ug DNA
EUR 167

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6933708 1.0 ug DNA
EUR 167

RGS11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1817806 1.0 ug DNA
EUR 167

RGS11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1817807 1.0 ug DNA
EUR 167

RGS11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1817808 1.0 ug DNA
EUR 167

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3530906 1.0 ug DNA
EUR 167

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3530907 1.0 ug DNA
EUR 167

Rgs11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3530908 1.0 ug DNA
EUR 167