RAD23A antibody
70R-1037	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RAD23A antibody

RAD23A antibody
70R-19745	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAD23A antibody

RAD23A antibody
38627-100ul	SAB	100ul	EUR 252

RAD23A Antibody
DF3632	Affbiotech	200ul	EUR 304
Description: RAD23A Antibody detects endogenous levels of total RAD23A.

RAD23A Antibody
DF7241	Affbiotech	200ul	EUR 304
Description: RAD23A Antibody detects endogenous levels of total RAD23A.

RAD23A Antibody
1-CSB-PA03774A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAD23A Antibody
1-CSB-PA040140	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

RAD23A antibody
70R-33857	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RAD23A antibody

RAD23A Antibody
1-CSB-PA019259GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAD23A siRNA
20-abx930765	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAD23A siRNA
20-abx930766	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAD23A Antibody
ABD3632	Lifescience Market	100 ug	EUR 438

RAD23A Antibody
ABD7241	Lifescience Market	100 ug	EUR 438

RAD23A Blocking Peptide
33R-3339	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23A antibody, catalog no. 70R-1037

RAD23A Blocking Peptide
33R-9737	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23A antibody, catalog no. 70R-1034

RAD23A antibody (HRP)
60R-1368	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RAD23A antibody (HRP)

RAD23A antibody (FITC)
60R-1369	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RAD23A antibody (FITC)

RAD23A antibody (biotin)
60R-1370	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RAD23A antibody (biotin)

RAD23A Blocking Peptide
DF3632-BP	Affbiotech	1mg	EUR 195

RAD23A Blocking Peptide
DF7241-BP	Affbiotech	1mg	EUR 195

RAD23A Conjugated Antibody
C38627	SAB	100ul	EUR 397

RAD23A cloning plasmid
CSB-CL019259HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1092 Sequence: atggccgtcaccatcacgctcaaaacgctgcagcagcagaccttcaagatccgcatggagcctgacgagacggtgaaggtgctaaaggagaagatagaagctgagaagggtcgtgatgccttccccgtggctggacagaaactcatctatgccggcaagatcttgagtgacgatg Show more
Description: A cloning plasmid for the RAD23A gene.

RAD23A Rabbit pAb
A3188-100ul	Abclonal	100 ul	EUR 308

RAD23A Rabbit pAb
A3188-200ul	Abclonal	200 ul	EUR 459

RAD23A Rabbit pAb
A3188-20ul	Abclonal	20 ul	EUR 183

RAD23A Rabbit pAb
A3188-50ul	Abclonal	50 ul	EUR 223

RAD23A Polyclonal Antibody
A53961	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Rad23A Polyclonal Antibody
ABP55970-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140 Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

Rad23A Polyclonal Antibody
ABP55970-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140 Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

Rad23A Polyclonal Antibody
ABP55970-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140 Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

anti- RAD23A antibody
FNab07076	FN Test	100µg	EUR 548.75
Immunogen: RAD23 homolog A(S. cerevisiae) Uniprot ID: P54725 Gene ID: 5886 Research Area: Metabolism
Description: Antibody raised against RAD23A

anti- RAD23A antibody
FNab07077	FN Test	100µg	EUR 548.75
Immunogen: RAD23 homolog A(S. cerevisiae) Uniprot ID: P54725 Gene ID: 5886 Research Area: Metabolism
Description: Antibody raised against RAD23A

Rad23A Polyclonal Antibody
ES6969-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Rad23A from Human/Mouse. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Rad23A Polyclonal Antibody
ES6969-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Rad23A from Human/Mouse. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Anti-RAD23A antibody
PAab07076	Lifescience Market	100 ug	EUR 386

Anti-RAD23A antibody
PAab07077	Lifescience Market	100 ug	EUR 386

Anti-RAD23A antibody
STJ11100760	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms.

Anti-RAD23A antibody
STJ25276	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms.

Anti-Rad23A antibody
STJ95326	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Rad23A.

RAD23A Antibody, HRP conjugated
1-CSB-PA03774B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAD23A Antibody, FITC conjugated
1-CSB-PA03774C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAD23A Antibody, Biotin conjugated
1-CSB-PA03774D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Rad23a ELISA KIT
ELI-18304m	Lifescience Market	96 Tests	EUR 865

RAD23A ELISA KIT|Human
EF002283	Lifescience Market	96 Tests	EUR 689

Mouse RAD23A shRNA Plasmid
20-abx972361	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAD23A shRNA Plasmid
20-abx953975	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine RAD23A ELISA KIT
ELI-35648b	Lifescience Market	96 Tests	EUR 928

Human RAD23A ELISA KIT
ELI-41102h	Lifescience Market	96 Tests	EUR 824

RAD23A Recombinant Protein (Human)
RP025630	ABM	100 ug	Ask for price

RAD23A Recombinant Protein (Mouse)
RP166481	ABM	100 ug	Ask for price

RAD23A Recombinant Protein (Rat)
RP223466	ABM	100 ug	Ask for price

RAD23A Polyclonal Antibody, HRP Conjugated
A53962	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RAD23A Polyclonal Antibody, FITC Conjugated
A53963	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RAD23A Polyclonal Antibody, Biotin Conjugated
A53964	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

[KO Validated] RAD23A Rabbit pAb
A19884-100ul	Abclonal	100 ul	EUR 410

[KO Validated] RAD23A Rabbit pAb
A19884-200ul	Abclonal	200 ul	EUR 571

[KO Validated] RAD23A Rabbit pAb
A19884-20ul	Abclonal	20 ul	EUR 221

[KO Validated] RAD23A Rabbit pAb
A19884-50ul	Abclonal	50 ul	EUR 287

Rad23a ORF Vector (Rat) (pORF)
ORF074490	ABM	1.0 ug DNA	EUR 506

RAD23A ORF Vector (Human) (pORF)
ORF008544	ABM	1.0 ug DNA	EUR 95

Rad23a ORF Vector (Mouse) (pORF)
ORF055495	ABM	1.0 ug DNA	EUR 506

Rad23a sgRNA CRISPR Lentivector set (Rat)
K6348001	ABM	3 x 1.0 ug	EUR 339

RAD23A sgRNA CRISPR Lentivector set (Human)
K1778801	ABM	3 x 1.0 ug	EUR 339

Rad23a sgRNA CRISPR Lentivector set (Mouse)
K3836501	ABM	3 x 1.0 ug	EUR 339

Rad23a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6348002	ABM	1.0 ug DNA	EUR 154

Rad23a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6348003	ABM	1.0 ug DNA	EUR 154

Rad23a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6348004	ABM	1.0 ug DNA	EUR 154

RAD23A sgRNA CRISPR Lentivector (Human) (Target 1)
K1778802	ABM	1.0 ug DNA	EUR 154

RAD23A sgRNA CRISPR Lentivector (Human) (Target 2)
K1778803	ABM	1.0 ug DNA	EUR 154

RAD23A sgRNA CRISPR Lentivector (Human) (Target 3)
K1778804	ABM	1.0 ug DNA	EUR 154

Rad23a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3836502	ABM	1.0 ug DNA	EUR 154

Rad23a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3836503	ABM	1.0 ug DNA	EUR 154

Rad23a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3836504	ABM	1.0 ug DNA	EUR 154

RAD23A Protein Vector (Rat) (pPB-C-His)
PV297958	ABM	500 ng	EUR 603

RAD23A Protein Vector (Rat) (pPB-N-His)
PV297959	ABM	500 ng	EUR 603

RAD23A Protein Vector (Rat) (pPM-C-HA)
PV297960	ABM	500 ng	EUR 603

RAD23A Protein Vector (Rat) (pPM-C-His)
PV297961	ABM	500 ng	EUR 603

RAD23A Protein Vector (Human) (pPB-C-His)
PV034173	ABM	500 ng	EUR 329

RAD23A Protein Vector (Human) (pPB-N-His)
PV034174	ABM	500 ng	EUR 329

RAD23A Protein Vector (Human) (pPM-C-HA)
PV034175	ABM	500 ng	EUR 329

RAD23A Protein Vector (Human) (pPM-C-His)
PV034176	ABM	500 ng	EUR 329

RAD23A Protein Vector (Mouse) (pPB-C-His)
PV221978	ABM	500 ng	EUR 603

RAD23A Protein Vector (Mouse) (pPB-N-His)
PV221979	ABM	500 ng	EUR 603

RAD23A Protein Vector (Mouse) (pPM-C-HA)
PV221980	ABM	500 ng	EUR 603

RAD23A Protein Vector (Mouse) (pPM-C-His)
PV221981	ABM	500 ng	EUR 603