RAD23A

RAD23A antibody

70R-1037 100 ug
EUR 377
Description: Rabbit polyclonal RAD23A antibody

RAD23A antibody

70R-19745 50 ul
EUR 435
Description: Rabbit polyclonal RAD23A antibody

RAD23A antibody

38627-100ul 100ul
EUR 252

RAD23A Antibody

DF3632 200ul
EUR 304
Description: RAD23A Antibody detects endogenous levels of total RAD23A.

RAD23A Antibody

DF7241 200ul
EUR 304
Description: RAD23A Antibody detects endogenous levels of total RAD23A.

RAD23A Antibody

1-CSB-PA03774A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAD23A Antibody

1-CSB-PA040140
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

RAD23A antibody

70R-33857 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody

RAD23A Antibody

1-CSB-PA019259GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAD23A siRNA

20-abx930765
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD23A siRNA

20-abx930766
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD23A Antibody

ABD3632 100 ug
EUR 438

RAD23A Antibody

ABD7241 100 ug
EUR 438

RAD23A Blocking Peptide

33R-3339 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23A antibody, catalog no. 70R-1037

RAD23A Blocking Peptide

33R-9737 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23A antibody, catalog no. 70R-1034

RAD23A antibody (HRP)

60R-1368 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody (HRP)

RAD23A antibody (FITC)

60R-1369 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody (FITC)

RAD23A antibody (biotin)

60R-1370 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody (biotin)

RAD23A Blocking Peptide

DF3632-BP 1mg
EUR 195

RAD23A Blocking Peptide

DF7241-BP 1mg
EUR 195

RAD23A Conjugated Antibody

C38627 100ul
EUR 397

RAD23A cloning plasmid

CSB-CL019259HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atggccgtcaccatcacgctcaaaacgctgcagcagcagaccttcaagatccgcatggagcctgacgagacggtgaaggtgctaaaggagaagatagaagctgagaagggtcgtgatgccttccccgtggctggacagaaactcatctatgccggcaagatcttgagtgacgatg
  • Show more
Description: A cloning plasmid for the RAD23A gene.

RAD23A Rabbit pAb

A3188-100ul 100 ul
EUR 308

RAD23A Rabbit pAb

A3188-200ul 200 ul
EUR 459

RAD23A Rabbit pAb

A3188-20ul 20 ul
EUR 183

RAD23A Rabbit pAb

A3188-50ul 50 ul
EUR 223

RAD23A Polyclonal Antibody

A53961 100 µg
EUR 570.55
Description: fast delivery possible

Rad23A Polyclonal Antibody

ABP55970-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

Rad23A Polyclonal Antibody

ABP55970-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

Rad23A Polyclonal Antibody

ABP55970-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

anti- RAD23A antibody

FNab07076 100µg
EUR 548.75
  • Immunogen: RAD23 homolog A(S. cerevisiae)
  • Uniprot ID: P54725
  • Gene ID: 5886
  • Research Area: Metabolism
Description: Antibody raised against RAD23A

anti- RAD23A antibody

FNab07077 100µg
EUR 548.75
  • Immunogen: RAD23 homolog A(S. cerevisiae)
  • Uniprot ID: P54725
  • Gene ID: 5886
  • Research Area: Metabolism
Description: Antibody raised against RAD23A

Rad23A Polyclonal Antibody

ES6969-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Rad23A from Human/Mouse. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Rad23A Polyclonal Antibody

ES6969-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Rad23A from Human/Mouse. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Anti-RAD23A antibody

PAab07076 100 ug
EUR 386

Anti-RAD23A antibody

PAab07077 100 ug
EUR 386

Anti-RAD23A antibody

STJ11100760 100 µl
EUR 413
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms.

Anti-RAD23A antibody

STJ25276 100 µl
EUR 277
Description: The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms.

Anti-Rad23A antibody

STJ95326 200 µl
EUR 197
Description: Rabbit polyclonal to Rad23A.

RAD23A Antibody, HRP conjugated

1-CSB-PA03774B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAD23A Antibody, FITC conjugated

1-CSB-PA03774C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAD23A Antibody, Biotin conjugated

1-CSB-PA03774D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Rad23a ELISA KIT

ELI-18304m 96 Tests
EUR 865

RAD23A ELISA KIT|Human

EF002283 96 Tests
EUR 689

Mouse RAD23A shRNA Plasmid

20-abx972361
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAD23A shRNA Plasmid

20-abx953975
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine RAD23A ELISA KIT

ELI-35648b 96 Tests
EUR 928

Human RAD23A ELISA KIT

ELI-41102h 96 Tests
EUR 824

RAD23A Recombinant Protein (Human)

RP025630 100 ug Ask for price

RAD23A Recombinant Protein (Mouse)

RP166481 100 ug Ask for price

RAD23A Recombinant Protein (Rat)

RP223466 100 ug Ask for price

RAD23A Polyclonal Antibody, HRP Conjugated

A53962 100 µg
EUR 570.55
Description: reagents widely cited

RAD23A Polyclonal Antibody, FITC Conjugated

A53963 100 µg
EUR 570.55
Description: Ask the seller for details

RAD23A Polyclonal Antibody, Biotin Conjugated

A53964 100 µg
EUR 570.55
Description: The best epigenetics products

[KO Validated] RAD23A Rabbit pAb

A19884-100ul 100 ul
EUR 410

[KO Validated] RAD23A Rabbit pAb

A19884-200ul 200 ul
EUR 571

[KO Validated] RAD23A Rabbit pAb

A19884-20ul 20 ul
EUR 221

[KO Validated] RAD23A Rabbit pAb

A19884-50ul 50 ul
EUR 287

Rad23a ORF Vector (Rat) (pORF)

ORF074490 1.0 ug DNA
EUR 506

RAD23A ORF Vector (Human) (pORF)

ORF008544 1.0 ug DNA
EUR 95

Rad23a ORF Vector (Mouse) (pORF)

ORF055495 1.0 ug DNA
EUR 506

Rad23a sgRNA CRISPR Lentivector set (Rat)

K6348001 3 x 1.0 ug
EUR 339

RAD23A sgRNA CRISPR Lentivector set (Human)

K1778801 3 x 1.0 ug
EUR 339

Rad23a sgRNA CRISPR Lentivector set (Mouse)

K3836501 3 x 1.0 ug
EUR 339

Rad23a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6348002 1.0 ug DNA
EUR 154

Rad23a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6348003 1.0 ug DNA
EUR 154

Rad23a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6348004 1.0 ug DNA
EUR 154

RAD23A sgRNA CRISPR Lentivector (Human) (Target 1)

K1778802 1.0 ug DNA
EUR 154

RAD23A sgRNA CRISPR Lentivector (Human) (Target 2)

K1778803 1.0 ug DNA
EUR 154

RAD23A sgRNA CRISPR Lentivector (Human) (Target 3)

K1778804 1.0 ug DNA
EUR 154

Rad23a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3836502 1.0 ug DNA
EUR 154

Rad23a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3836503 1.0 ug DNA
EUR 154

Rad23a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3836504 1.0 ug DNA
EUR 154

RAD23A Protein Vector (Rat) (pPB-C-His)

PV297958 500 ng
EUR 603

RAD23A Protein Vector (Rat) (pPB-N-His)

PV297959 500 ng
EUR 603

RAD23A Protein Vector (Rat) (pPM-C-HA)

PV297960 500 ng
EUR 603

RAD23A Protein Vector (Rat) (pPM-C-His)

PV297961 500 ng
EUR 603

RAD23A Protein Vector (Human) (pPB-C-His)

PV034173 500 ng
EUR 329

RAD23A Protein Vector (Human) (pPB-N-His)

PV034174 500 ng
EUR 329

RAD23A Protein Vector (Human) (pPM-C-HA)

PV034175 500 ng
EUR 329

RAD23A Protein Vector (Human) (pPM-C-His)

PV034176 500 ng
EUR 329

RAD23A Protein Vector (Mouse) (pPB-C-His)

PV221978 500 ng
EUR 603

RAD23A Protein Vector (Mouse) (pPB-N-His)

PV221979 500 ng
EUR 603

RAD23A Protein Vector (Mouse) (pPM-C-HA)

PV221980 500 ng
EUR 603

RAD23A Protein Vector (Mouse) (pPM-C-His)

PV221981 500 ng
EUR 603