RAB5A

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

DLR-RAB5A-Hu-96T 96T
EUR 673
  • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

DLR-RAB5A-Mu-48T 48T
EUR 527
  • Should the Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

DLR-RAB5A-Mu-96T 96T
EUR 688
  • Should the Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RDR-RAB5A-Hu-48Tests 48 Tests
EUR 544

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RDR-RAB5A-Hu-96Tests 96 Tests
EUR 756

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RDR-RAB5A-Mu-48Tests 48 Tests
EUR 557

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RDR-RAB5A-Mu-96Tests 96 Tests
EUR 774

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RD-RAB5A-Hu-48Tests 48 Tests
EUR 521

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RD-RAB5A-Hu-96Tests 96 Tests
EUR 723

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RD-RAB5A-Mu-48Tests 48 Tests
EUR 533

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

RD-RAB5A-Mu-96Tests 96 Tests
EUR 740

RAB5A protein

30R-1120 100 ug
EUR 397
Description: Purified recombinant Human RAB5A protein

RAB5A Antibody

31147-100ul 100ul
EUR 252

RAB5A Antibody

31147-50ul 50ul
EUR 187

RAB5A antibody

70R-19719 50 ul
EUR 435
Description: Rabbit polyclonal RAB5A antibody

RAB5A antibody

70R-14310 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal RAB5A antibody

RAB5A Antibody

32209-100ul 100ul
EUR 252

RAB5a antibody

10R-1064 100 ul
EUR 349
Description: Mouse monoclonal Rab5a antibody

RAB5A Antibody

1-CSB-PA005820
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RAB5A Antibody

1-CSB-PA053446
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:500-1:2000

RAB5A Antibody

DF6314 200ul
EUR 304
Description: RAB5A Antibody detects endogenous levels of total RAB5A.

RAB5A Antibody

CSB-PA280354-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RAB5A Antibody

CSB-PA280354-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

RAB5A Antibody

1-CSB-PA298327
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:3000

RAB5A antibody

70R-5813 50 ug
EUR 467
Description: Rabbit polyclonal RAB5A antibody raised against the middle region of RAB5A

RAB5A antibody

70R-5861 50 ug
EUR 467
Description: Rabbit polyclonal RAB5A antibody raised against the middle region of RAB5A

Rab5A Antibody

AF5104 200ul
EUR 304
Description: Rab5A Antibody detects endogenous levels of total Rab5A.

RAB5A Antibody

1-CSB-PA019213EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RAB5A Antibody

1-CSB-PA019213ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

RAB5A Antibody

1-CSB-PA019213GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB5A Antibody

1-CSB-PA019213HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB5A. Recognizes RAB5A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB5A siRNA

20-abx930693
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB5A siRNA

20-abx930694
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB5A Antibody

ABD6314 100 ug
EUR 438

Rab5A Antibody

ABF5104 100 ug
EUR 438

pENTR223- RAB5A

PVT11398 2 ug
EUR 273

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx214971
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx178209
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx178210
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rab5A, Member Ras Oncogene Family (RAB5A) Antibody

20-abx114997
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx125387
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx129219
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RAB5A, Member RAS Oncogene Family (Rab5A) Antibody

abx147202-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

abx147203-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx137402
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx142185
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx174327
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx241128
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx318742
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

abx237038-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

abx332146-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx327649
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx322334
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (Rab5a) Antibody

abx224377-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Antibody

20-abx001094
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant RAB5A, Member RAS Oncogene Family (RAB5A)

4-RPK305Hu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20339
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human RAB5A, Member RAS Oncogene Family expressed in: E.coli

Human RAB5A, Member RAS Oncogene Family (RAB5A) Protein

20-abx168274
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) Protein

20-abx654901
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) Protein

20-abx654902
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Rab5a Antibody

31221-05111 150 ug
EUR 261

RAB5A Blocking Peptide

33R-4691 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5A antibody, catalog no. 70R-5813

RAB5A Blocking Peptide

33R-8417 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5A antibody, catalog no. 70R-5861

RAB5A Blocking Peptide

DF6314-BP 1mg
EUR 195

Rab5A Blocking Peptide

AF5104-BP 1mg
EUR 195

RAB5A Conjugated Antibody

C32209 100ul
EUR 397

RAB5A Conjugated Antibody

C31147 100ul
EUR 397

RAB5A-Specific Antibody

abx237039-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RAB5A Antibody (HRP)

20-abx315960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5A Antibody (FITC)

20-abx315961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5A Antibody (Biotin)

20-abx315962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5A cloning plasmid

CSB-CL019213HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggctagtcgaggcgcaacaagacccaacgggccaaatactggaaataaaatatgccagttcaaactagtacttctgggagagtccgctgttggcaaatcaagcctagtgcttcgttttgtgaaaggccaatttcatgaatttcaagagagtaccattggggctgcttttctaac
  • Show more
Description: A cloning plasmid for the RAB5A gene.

RAB5A Polyclonal Antibody

A56042 100 µg
EUR 570.55
Description: Ask the seller for details

anti- RAB5A antibody

FNab07038 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP:1:200-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: RAB5A, member RAS oncogene family
  • Uniprot ID: P20339
  • Gene ID: 5868
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB5A

Anti-RAB5A antibody

PAab07038 100 ug
EUR 355

EGFP- Rab5A Q79L

PVT10346 2 ug
EUR 266

pEGFP-RAB5A Plasmid

PVT15986 2 ug
EUR 325

pDsRed2-RAB5A Plasmid

PVT16086 2 ug
EUR 325

Anti-RAB5A antibody

STJ25263 100 µl
EUR 413

Anti-Rab5a antibody

STJ140060 200 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab5a. Rab5a belongs to the small GTPase superfamily, Rab family. Rab5a is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis

Anti-Rab5a antibody

STJ140104 200 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab5a. Rab5a belongs to the small GTPase superfamily, Rab family. Rab5a is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis.

Human RAB5A, Member RAS Oncogene Family (RAB5A) CLIA Kit

20-abx190332
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) CLIA Kit

20-abx190597
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

20-abx154598
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit

20-abx152912
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

RAB5A, Member RAS Oncogene Family (RAB5A) Polyclonal Antibody (Human)

4-PAK305Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RAB5A (Met1~Ser214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human RAB5A, Member RAS Oncogene Family (RAB5A)