PSMC3

PSMC3 siRNA

20-abx904321
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC3 siRNA

20-abx930166
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC3 siRNA

20-abx930167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC3 Antibody

ABD6737 100 ug
EUR 438

PSMC3 Antibody

32537-100ul 100ul
EUR 252

PSMC3 antibody

22558-100ul 100ul
EUR 390

PSMC3 antibody

10R-5484 100 ul
EUR 726
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5485 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5486 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5487 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5488 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5489 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5491 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5493 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

10R-5494 100 ul
EUR 691
Description: Mouse monoclonal PSMC3 antibody

PSMC3 antibody

70R-13293 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PSMC3 antibody

PSMC3 Antibody

DF6737 200ul
EUR 304
Description: PSMC3 Antibody detects endogenous levels of total PSMC3.

PSMC3 Antibody

1-CSB-PA040034
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PSMC3. Recognizes PSMC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

PSMC3 Antibody

1-CSB-PA018891LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC3. Recognizes PSMC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:500-1:1000

anti-PSMC3

YF-PA14124 50 ug
EUR 363
Description: Mouse polyclonal to PSMC3

anti-PSMC3

YF-PA14125 100 ug
EUR 403
Description: Rabbit polyclonal to PSMC3

Polyclonal PSMC3 Antibody

AMR09580G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC3 . This antibody is tested and proven to work in the following applications:

PSMC3 Conjugated Antibody

C32537 100ul
EUR 397

PSMC3 cloning plasmid

CSB-CL018891HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: ATGAATCTGCTGCCGAATATTGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGGAGGAGGTGCTCAAGATGTCCACGGAGGAGATCATCCAGCGCACACGGCTGCTGGACAGTGAGATCAAGATCATGAAGAGTGAAG
  • Show more
Description: A cloning plasmid for the PSMC3 gene.

PSMC3 Polyclonal Antibody

ES6865-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PSMC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PSMC3 Polyclonal Antibody

ES6865-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PSMC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- PSMC3 antibody

FNab06879 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) 26S subunit, ATPase, 3
  • Uniprot ID: P17980
  • Gene ID: 5702
  • Research Area: Metabolism
Description: Antibody raised against PSMC3

PSMC3 Polyclonal Antibody

ABP55866-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC3 from Human, Mouse, Rat. This PSMC3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC3 at AA range: 240-320

PSMC3 Polyclonal Antibody

ABP55866-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC3 from Human, Mouse, Rat. This PSMC3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC3 at AA range: 240-320

PSMC3 Polyclonal Antibody

ABP55866-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC3 from Human, Mouse, Rat. This PSMC3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC3 at AA range: 240-320

PSMC3 Blocking Peptide

20-abx061076
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PSMC3 Polyclonal Antibody

A63246 100 µg
EUR 570.55
Description: reagents widely cited

PSMC3 Rabbit pAb

A13345-100ul 100 ul
EUR 308

PSMC3 Rabbit pAb

A13345-200ul 200 ul
EUR 459

PSMC3 Rabbit pAb

A13345-20ul 20 ul
EUR 183

PSMC3 Rabbit pAb

A13345-50ul 50 ul
EUR 223

PSMC3 Rabbit pAb

A1986-100ul 100 ul
EUR 308

PSMC3 Rabbit pAb

A1986-200ul 200 ul
EUR 459

PSMC3 Rabbit pAb

A1986-20ul 20 ul
EUR 183

PSMC3 Rabbit pAb

A1986-50ul 50 ul
EUR 223

PSMC3 Blocking Peptide

DF6737-BP 1mg
EUR 195

Anti-PSMC3 antibody

PAab06879 100 ug
EUR 412

anti-PSMC3 (1B9)

LF-MA10254 100 ug
EUR 363
Description: Mouse monoclonal to PSMC3

Anti-PSMC3 antibody

STJ95249 200 µl
EUR 197
Description: Rabbit polyclonal to PSMC3.

Anti-PSMC3 antibody

STJ25182 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9.

Anti-PSMC3 antibody

STJ115308 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9.

Rat PSMC3 shRNA Plasmid

20-abx985662
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC3 ELISA KIT|Human

EF002121 96 Tests
EUR 689

Human PSMC3 shRNA Plasmid

20-abx953849
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMC3 shRNA Plasmid

20-abx972246
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC3 Antibody, HRP conjugated

1-CSB-PA018891LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC3. Recognizes PSMC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMC3 Antibody, FITC conjugated

1-CSB-PA018891LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC3. Recognizes PSMC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC3 Antibody, Biotin conjugated

1-CSB-PA018891LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC3. Recognizes PSMC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMC3 Recombinant Protein (Human)

RP042565 100 ug Ask for price

PSMC3 Recombinant Protein (Rat)

RP222641 100 ug Ask for price