PSMB1

PSMB1 antibody

70R-19580 50 ul
EUR 435
Description: Rabbit polyclonal PSMB1 antibody

PSMB1 antibody

70R-2340 50 ug
EUR 467
Description: Rabbit polyclonal PSMB1 antibody

PSMB1 antibody

70R-15188 100 ug
EUR 327
Description: Rabbit polyclonal PSMB1 antibody

PSMB1 Antibody

32130-100ul 100ul
EUR 252

PSMB1 Antibody

DF6193 200ul
EUR 304
Description: PSMB1 Antibody detects endogenous levels of total PSMB1.

PSMB1 Antibody

1-CSB-PA01395A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB1. Recognizes PSMB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

PSMB1 Antibody

1-CSB-PA018876GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB1. Recognizes PSMB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PSMB1 siRNA

20-abx904310
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB1 siRNA

20-abx930142
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB1 siRNA

20-abx930143
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB1 Antibody

ABD6193 100 ug
EUR 438

pOTB7-PSMB1

PVT18277 2 ug
EUR 231

PSMB1 Rabbit pAb

A1043-100ul 100 ul
EUR 308

PSMB1 Rabbit pAb

A1043-200ul 200 ul
EUR 459

PSMB1 Rabbit pAb

A1043-20ul 20 ul
EUR 183

PSMB1 Rabbit pAb

A1043-50ul 50 ul
EUR 223

PSMB1 Blocking Peptide

33R-6806 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB1 antibody, catalog no. 70R-2340

PSMB1 antibody (HRP)

60R-1403 100 ug
EUR 327
Description: Rabbit polyclonal PSMB1 antibody (HRP)

PSMB1 antibody (biotin)

60R-1404 100 ug
EUR 327
Description: Rabbit polyclonal PSMB1 antibody (biotin)

PSMB1 antibody (FITC)

60R-1405 100 ug
EUR 327
Description: Rabbit polyclonal PSMB1 antibody (FITC)

PSMB1 Blocking Peptide

DF6193-BP 1mg
EUR 195

PSMB1 Conjugated Antibody

C32130 100ul
EUR 397

PSMB1 cloning plasmid

CSB-CL018876HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgttgtcctctacagccatgtattcggctgctggcagagacttggggatggaaccgcacagagccgcgggccctttgcagctgcgattttcgccctacgttttcaacggaggtactatactggcaattgctggagaagattttgcaattgttgcttctgatactcgattgagtga
  • Show more
Description: A cloning plasmid for the PSMB1 gene.

PSMB1 cloning plasmid

CSB-CL018876HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgttgtcctctacagccatgtattcggctcctggcagagacttggggatggaaccgcacagagccgcgggccctttgcagctgcgattttcgccctacgttttcaacggaggtactatactggcaattgctggagaagattttgcaattgttgcttctgatactcgattgagtga
  • Show more
Description: A cloning plasmid for the PSMB1 gene.

PSMB1 Polyclonal Antibody

A52597 100 µg
EUR 570.55
Description: The best epigenetics products

anti- PSMB1 antibody

FNab06868 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) subunit, beta type, 1
  • Uniprot ID: P20618
  • Gene ID: 5689
  • Research Area: Metabolism
Description: Antibody raised against PSMB1

Anti-PSMB1 antibody

PAab06868 100 ug
EUR 355

Anti-PSMB1 antibody

STJ26164 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species.

PSMB1 Antibody, HRP conjugated

1-CSB-PA01395B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB1. Recognizes PSMB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMB1 Antibody, FITC conjugated

1-CSB-PA01395C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB1. Recognizes PSMB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMB1 Antibody, Biotin conjugated

1-CSB-PA01395D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB1. Recognizes PSMB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMB1 protein (His tag)

80R-1120 100 ug
EUR 586
Description: Purified recombinant Human PSMB1 protein

PSMB1 ELISA KIT|Human

EF002109 96 Tests
EUR 689

Mouse PSMB1 shRNA Plasmid

20-abx972239
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMB1 shRNA Plasmid

20-abx987086
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMB1 shRNA Plasmid

20-abx953836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMB1 Recombinant Protein (Human)

RP024910 100 ug Ask for price

PSMB1 Recombinant Protein (Human)

RP024913 100 ug Ask for price

PSMB1 Recombinant Protein (Mouse)

RP165260 100 ug Ask for price

PSMB1 Recombinant Protein (Rat)

RP222602 100 ug Ask for price

Polyclonal PSMB1 Antibody (C-term)

APR06126G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB1 (C-term). This antibody is tested and proven to work in the following applications:

PSMB1 Polyclonal Antibody, HRP Conjugated

A52598 100 µg
EUR 570.55
Description: kits suitable for this type of research

PSMB1 Polyclonal Antibody, FITC Conjugated

A52599 100 µg
EUR 570.55
Description: fast delivery possible

PSMB1 Polyclonal Antibody, Biotin Conjugated

A52600 100 µg
EUR 570.55
Description: reagents widely cited

Psmb1 ORF Vector (Rat) (pORF)

ORF074202 1.0 ug DNA
EUR 506

PSMB1 ORF Vector (Human) (pORF)

ORF008304 1.0 ug DNA
EUR 95

PSMB1 ORF Vector (Human) (pORF)

ORF008305 1.0 ug DNA
EUR 95

Psmb1 ORF Vector (Mouse) (pORF)

ORF055088 1.0 ug DNA
EUR 506

PSMB1 ELISA Kit (Human) (OKEH07550)

OKEH07550 96 Wells
EUR 896
Description: Description of target: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.395ng/mL

Rabbit Anti-Human PSMB1 polyclonal antibody

CABT-BL008 100 ul
EUR 585

Psmb1 sgRNA CRISPR Lentivector set (Rat)

K7051101 3 x 1.0 ug
EUR 339

Psmb1 sgRNA CRISPR Lentivector set (Mouse)

K4602701 3 x 1.0 ug
EUR 339

PSMB1 sgRNA CRISPR Lentivector set (Human)

K1739401 3 x 1.0 ug
EUR 339

Human Proteasome subunit beta type-1 (PSMB1)

1-CSB-RP013954h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasome subunit beta type-1(PSMB1) expressed in E.coli

Proteasome Subunit Beta Type 1 (PSMB1) Antibody

20-abx114767
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.