PPP6C antibody

70R-19493 50 ul
EUR 435
Description: Rabbit polyclonal PPP6C antibody

PPP6C Antibody

39981-100ul 100ul
EUR 390

PPP6C Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PPP6C. Recognizes PPP6C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PPP6C Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPP6C. Recognizes PPP6C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27334 50 ug
EUR 363
Description: Mouse polyclonal to PPP6C

PPP6C Polyclonal Antibody

30515-100ul 100ul
EUR 252

PPP6C Polyclonal Antibody

30515-50ul 50ul
EUR 187

Polyclonal PPP6C Antibody

AMM07310G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPP6C . This antibody is tested and proven to work in the following applications:

PPP6C cloning plasmid

CSB-CL018583HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atggcgccgctagacctggacaagtatgtggaaatagcgcggctgtgcaagtacctgccagagaacgacctgaagcggctatgtgactacgtttgtgacctcctcttagaagagtcaaatgttcagccagtatcaacaccagtaacagtgtgtggagatatccatggacagtttta
  • Show more
Description: A cloning plasmid for the PPP6C gene.

PPP6C Rabbit pAb

A4039-100ul 100 ul
EUR 308

PPP6C Rabbit pAb

A4039-200ul 200 ul
EUR 459

PPP6C Rabbit pAb

A4039-20ul 20 ul
EUR 183

PPP6C Rabbit pAb

A4039-50ul 50 ul
EUR 223

anti- PPP6C antibody

FNab06736 100µg
EUR 548.75
  • Immunogen: protein phosphatase 6, catalytic subunit
  • Uniprot ID: O00743
  • Gene ID: 5537
  • Research Area: Metabolism
Description: Antibody raised against PPP6C

Anti-PPP6C antibody

PAab06736 100 ug
EUR 386

Anti-PPP6C antibody

STJ25097 100 µl
EUR 277
Description: This gene encodes the catalytic subunit of protein phosphatase, a component of a signaling pathway regulating cell cycle progression. Splice variants encoding different protein isoforms exist. The pseudogene of this gene is located on chromosome X.

Anti-PPP6C (1B7)

YF-MA14859 100 ug
EUR 363
Description: Mouse monoclonal to PPP6C


EF002025 96 Tests
EUR 689

Rat PPP6C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PPP6C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PPP6C Polyclonal Conjugated Antibody

C30515 100ul
EUR 397

PPP6C Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPP6C. Recognizes PPP6C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PPP6C Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPP6C. Recognizes PPP6C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PPP6C Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPP6C. Recognizes PPP6C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PPP6C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-36549h 96 Tests
EUR 824

Mouse Ppp6c ELISA KIT

ELI-36550m 96 Tests
EUR 865

PPP6C Recombinant Protein (Human)

RP024454 100 ug Ask for price

PPP6C Recombinant Protein (Mouse)

RP164090 100 ug Ask for price

PPP6C Recombinant Protein (Rat)

RP221861 100 ug Ask for price

Polyclonal PPP6C Antibody (N-term)

AMM08668G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPP6C (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal PPP6C Antibody (C-term)

APR14379G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPP6C (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal PPP6C Antibody (C-term)

AMM07311G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPP6C (C-term). This antibody is tested and proven to work in the following applications:

Ppp6c ORF Vector (Rat) (pORF)

ORF073955 1.0 ug DNA
EUR 506

PPP6C ORF Vector (Human) (pORF)

ORF008152 1.0 ug DNA
EUR 95

Ppp6c ORF Vector (Mouse) (pORF)

ORF054698 1.0 ug DNA
EUR 506

Polyclonal PPP6C Antibody - C-terminal region

AMM07319G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPP6C - C-terminal region. This antibody is tested and proven to work in the following applications:

Ppp6c sgRNA CRISPR Lentivector set (Mouse)

K5014901 3 x 1.0 ug
EUR 339

Ppp6c sgRNA CRISPR Lentivector set (Rat)

K7091301 3 x 1.0 ug
EUR 339

PPP6C sgRNA CRISPR Lentivector set (Human)

K1710001 3 x 1.0 ug
EUR 339

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Phosphatase 6, Catalytic Subunit (PPP6C) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Phosphatase 6, Catalytic Subunit (PPP6C) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

abx036245-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

abx038318-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

abx033967-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

abx033967-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

abx236736-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Protein Phosphatase 6 Catalytic Subunit (PPP6C) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ppp6c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5014902 1.0 ug DNA
EUR 154

Ppp6c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5014903 1.0 ug DNA
EUR 154

Ppp6c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5014904 1.0 ug DNA
EUR 154