cusabio antibody

PPM1M-antilichaam van CUSABIO Technology LLC

CUSABIO BIOTECH CO., Ltd. is een biotechbedrijf dat onderzoek, reagentia en instrumenten van de hoogste kwaliteit produceert en verkoopt. In samenwerking met zakelijke partners op topniveau op het gebied van moleculaire biologie, immunologie, celbiologie en IVD.

Ze leveren producten en diensten aan een breed scala aan klanten over de hele wereld – van academische en overheidsonderzoeksinstellingen; biotechnologische en farmaceutische bedrijven; evenals ziekenhuizen, referentielaboratoria. In de afgelopen ontwikkeling heeft CUSABIO BIOTECH CO., Ltd. een uitgebreid verkoop- en marketingbeheernetwerksysteem gevormd ten dienste van de Life Science-onderzoekers en professionals in de gezondheidszorg.

De belangrijkste producten van CUSABIO BIOTECH CO., Ltd. zijn ELISA-kits en verwante producten en andere immunologische reagentia, zoals antilichamen. Hun belangrijkste klanten zijn professor, onderzoeker en experts van de universiteit, het ziekenhuis en de onderzoeksinstelling. Hun verkoopstrategie is actieve verkoop, internet en telefonisch.

Om de Chinese markt uit te breiden en de productiekosten te verlagen, kocht CUSABIO BIOTECH CO., Ltd. in augustus 2008 WUHAN HUAMEI BIOTECH CO., Ltd., dat een volledige dochteronderneming werd. WUHAN HUAMEI BIOTECH CO., Ltd. is gevestigd in Wuhan, PR China en bestaat uit een product- en verkoopteam dat producten levert voor de ontwikkeling van biotechnologie in China. CUSABIO BIOTECH CO., Ltd. wordt een R&D-centrum voor levenswetenschappen.

Hun moderne logistieke systeem zorgt ervoor dat goederen tijdig worden geleverd dankzij de hedendaagse elektronische handel en e-supply. Bijgevolg zal dit een constante verbetering van de klanttevredenheid in de snelgroeiende wereldmarkt bevorderen.

cusabio
cusabio

Antilichamen

Al onze antistoffen op één plek om gemakkelijk te zoeken en sneller en gemakkelijker het juiste product te vinden.

 

We waarderen uw bedrijf en zijn toegewijd aan het leveren van het hoogste niveau van kwaliteit en service. Onze antilichamen werken gegarandeerd in de toepassing en soorten die op onze website en in onze datasheets worden vermeld. In het geval dat een antilichaam niet werkt, zal onze technische afdeling met u samenwerken om het probleem op te lossen. Als dit proces niet succesvol is, zal G-Biosciences u een gratis vervanging of 100% terugbetaling voor het antilichaam verstrekken. Ons beleid is één jaar geldig vanaf de datum van uw aankoop, tenzij anders vermeld in de productdatasheet.

 

Antilichamen kunnen twee weken nodig hebben voor levering.

Cusabio

Cusabio  is een toonaangevend biotechnologiebedrijf opgericht in 2007 en gespecialiseerd in de productie van hoogwaardige antilichamen, ELISA-kits, recombinante eiwitten en kleine moleculen. Cusabio  is gecertificeerd volgens DIN ISO 9001, omdat hun doel is om producten van de hoogste kwaliteit te leveren door strikte controles uit te voeren in elke stap van de ontwikkeling en productie van hun producten.

Daarnaast heeft  Cusabio  meer dan 60.000 soorten antistoffen. De meeste van deze antilichamen worden polyklonaal geproduceerd in konijnen, maar ze produceren ook polyklonale antilichamen die worden gemaakt in cavia’s en geiten en hun antilichaamportfolio wordt aangevuld met verschillende zeer specifieke monoklonale muizenantilichamen. Bijna alle primaire antilichamen van  Cusabio  kunnen zowel als ongeconjugeerde antilichamen als geconjugeerd aan biotine, HRP en FITC worden geleverd, zodat de gebruiker vrij kan kiezen wat betreft het detectiesysteem. Aangezien de meeste antilichamen van deze fabrikant geschikt zijn voor de detectie van menselijke antigenen, zijn de primaire antilichamen van  Cusabio die beschikbaar zijn bij Bio-Connect Diagnostics zijn van groot belang voor wetenschappers die onderzoek doen naar de menselijke stofwisseling, auto-immuunziekten, neurobiologie etc.

PPM1M antibody
70R-3588 50 ug
EUR 467
Description: Rabbit polyclonal PPM1M antibody raised against the middle region of PPM1M
PPM1M antibody
70R-3594 50 ug
EUR 467
Description: Rabbit polyclonal PPM1M antibody
PPM1M Antibody
1-CSB-PA018499GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PPM1M Polyclonal Antibody
28580-100ul 100ul
EUR 252
PPM1M Polyclonal Antibody
28580-50ul 50ul
EUR 187
PPM1M Polyclonal Antibody
A60378 100 µg
EUR 570.55
Description: fast delivery possible
anti- PPM1M antibody
FNab06690 100µg
EUR 585
  • Immunogen: protein phosphatase 1M(PP2C domain containing)
  • Uniprot ID: Q96MI6
  • Gene ID: 132160
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PPM1M
Anti-PPM1M antibody
PAab06690 100 ug
EUR 412
Anti-PPM1M antibody
STJ116656 100 µl
EUR 277
PPM1M siRNA
20-abx929445
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPM1M siRNA
20-abx929446
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PPM1M
YF-PA26876 50 ul
EUR 334
Description: Mouse polyclonal to PPM1M
PPM1M Antibody, HRP conjugated
1-CSB-PA842717LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PPM1M Antibody, FITC conjugated
1-CSB-PA842717LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PPM1M Antibody, Biotin conjugated
1-CSB-PA842717LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against PPM1M. Recognizes PPM1M from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal PPM1M Antibody (Center)
AMM08666G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPM1M (Center). This antibody is tested and proven to work in the following applications:
PPM1M Polyclonal Conjugated Antibody
C28580 100ul
EUR 397
PPM1M Rabbit pAb
A14446-100ul 100 ul
EUR 308
PPM1M Rabbit pAb
A14446-200ul 200 ul
EUR 459
PPM1M Rabbit pAb
A14446-20ul 20 ul
EUR 183
PPM1M Rabbit pAb
A14446-50ul 50 ul
EUR 223
PPM1M Blocking Peptide
33R-8149 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1M antibody, catalog no. 70R-3594
PPM1M Blocking Peptide
33R-9923 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPM1M antibody, catalog no. 70R-3588
PPM1M cloning plasmid
CSB-CL842717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atgggcggctgcacagccctggtggctgtgtccctgcagggaaagctgtacatggccaatgctggggatagcagggccatcttggtgcggagagatgagatacggccactgagcttcgagttcaccccagagactgagcggcagcggatccagcagctggcctttgtctatcctga
  • Show more
Description: A cloning plasmid for the PPM1M gene.
Scroll to Top