Progesterone (Pg) ELISA Kit
DLR-Pg-Ge-96T	DL Develop	96T	EUR 608
Should the Progesterone (Pg) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Progesterone (Pg) in samples from serum, plasma or other biological fluids.

General Progesterone (Pg) ELISA Kit
RDR-Pg-Ge-48Tests	Reddot Biotech	48 Tests	EUR 488

General Progesterone (Pg) ELISA Kit
RDR-Pg-Ge-96Tests	Reddot Biotech	96 Tests	EUR 676

General Progesterone (Pg) ELISA Kit
RD-Pg-Ge-48Tests	Reddot Biotech	48 Tests	EUR 467

General Progesterone (Pg) ELISA Kit
RD-Pg-Ge-96Tests	Reddot Biotech	96 Tests	EUR 646

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
DLR-ESAM-Hu-48T	DL Develop	48T	EUR 517
Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
DLR-ESAM-Hu-96T	DL Develop	96T	EUR 673
Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RDR-ESAM-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RDR-ESAM-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RD-ESAM-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit
RD-ESAM-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Esam/ Rat Esam ELISA Kit
ELI-20559r	Lifescience Market	96 Tests	EUR 886

ESAM antibody
70R-17149	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ESAM antibody

ESAM Antibody
1-CSB-PA850258LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESAM Antibody
1-CSB-PA007818GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ESAM siRNA
20-abx901776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ESAM siRNA
20-abx915678	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ESAM siRNA
20-abx915679	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ESAM
YF-PA21677	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ESAM

anti-ESAM
YF-PA21678	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to ESAM

anti-ESAM
YF-PA21679	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to ESAM

PG-cholesterylamine
36700	AAT Bioquest	1 mg	EUR 480
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

PG 106
B5768-1	ApexBio	1 mg	EUR 480

PG 931
B5807-1	ApexBio	1 mg	EUR 486

PG 01
B7545-10	ApexBio	10 mg	EUR 334

PG 01
B7545-50	ApexBio	50 mg	EUR 1243

pG+HOST9
PVT11382	Lifescience Market	2 ug	EUR 370

ESAM Polyclonal Antibody
27645-100ul	SAB	100ul	EUR 252

ESAM Polyclonal Antibody
27645-50ul	SAB	50ul	EUR 187

ESAM Rabbit pAb
A12210-100ul	Abclonal	100 ul	EUR 308

ESAM Rabbit pAb
A12210-200ul	Abclonal	200 ul	EUR 459

ESAM Rabbit pAb
A12210-20ul	Abclonal	20 ul	EUR 183

ESAM Rabbit pAb
A12210-50ul	Abclonal	50 ul	EUR 223

ESAM Polyclonal Antibody
ABP58502-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ESAM protein Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody
ABP58502-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ESAM protein Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody
ABP58502-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ESAM protein Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM cloning plasmid
CSB-CL850258HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1173 Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg Show more
Description: A cloning plasmid for the ESAM gene.

ESAM Polyclonal Antibody
A55335	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ESAM Polyclonal Antibody
ES11142-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Polyclonal Antibody
ES11142-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- ESAM antibody
FNab02860	FN Test	100µg	EUR 548.75
Immunogen: endothelial cell adhesion molecule Uniprot ID: Q96AP7 Gene ID: 90952 Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM

Anti-ESAM antibody
PAab02860	Lifescience Market	100 ug	EUR 386

Anti-ESAM antibody
STJ114102	St John's Laboratory	100 µl	EUR 277

Anti-ESAM antibody
STJ192300	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM

Anti-ESAM (1G8)
YF-MA19632	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ESAM

Anti-ESAM (1E4)
YF-MA19633	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ESAM

PG-A/ Rat PG- A ELISA Kit
ELA-E0165r	Lifescience Market	96 Tests	EUR 886

PG-E2/ Rat PG- E2 ELISA Kit
ELA-E0538r	Lifescience Market	96 Tests	EUR 886

PG-E1/ Rat PG- E1 Elisa Kit
ELA-E0904r	Lifescience Market	96 Tests	EUR 886

Human versican/PG-M/PG-350 ELISA kit
CSB-E11884h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human versican/PG-M/PG-350 in samples from serum, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human versican/PG-M/PG-350 ELISA kit
1-CSB-E11884h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human versican/PG-M/PG-350 in samples from serum, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PG-9 maleate
B6435-10	ApexBio	10 mg	EUR 268

PG-9 maleate
B6435-50	ApexBio	50 mg	EUR 973

Progesterone (PG) Antibody
20-abx100640	Abbexa	EUR 398.00 EUR 133.00 EUR 1080.00 EUR 537.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

PG 01037 dihydrochloride
B7524-10	ApexBio	10 mg	EUR 258