pg esam

Progesterone (Pg) ELISA Kit

DLR-Pg-Ge-96T 96T
EUR 608
  • Should the Progesterone (Pg) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Progesterone (Pg) in samples from serum, plasma or other biological fluids.

General Progesterone (Pg) ELISA Kit

RDR-Pg-Ge-48Tests 48 Tests
EUR 488

General Progesterone (Pg) ELISA Kit

RDR-Pg-Ge-96Tests 96 Tests
EUR 676

General Progesterone (Pg) ELISA Kit

RD-Pg-Ge-48Tests 48 Tests
EUR 467

General Progesterone (Pg) ELISA Kit

RD-Pg-Ge-96Tests 96 Tests
EUR 646

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

EUR 517
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

EUR 673
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-48Tests 48 Tests
EUR 544

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-96Tests 96 Tests
EUR 756

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-48Tests 48 Tests
EUR 521

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-96Tests 96 Tests
EUR 723

Esam/ Rat Esam ELISA Kit

ELI-20559r 96 Tests
EUR 886

ESAM antibody

70R-17149 50 ul
EUR 435
Description: Rabbit polyclonal ESAM antibody

ESAM Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESAM Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21677 50 ug
EUR 363
Description: Mouse polyclonal to ESAM


YF-PA21678 100 ul
EUR 403
Description: Rabbit polyclonal to ESAM


YF-PA21679 100 ug
EUR 403
Description: Rabbit polyclonal to ESAM


36700 1 mg
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

PG 106

B5768-1 1 mg
EUR 480

PG 931

B5807-1 1 mg
EUR 486

PG 01

B7545-10 10 mg
EUR 334

PG 01

B7545-50 50 mg
EUR 1243


PVT11382 2 ug
EUR 370

ESAM Polyclonal Antibody

27645-100ul 100ul
EUR 252

ESAM Polyclonal Antibody

27645-50ul 50ul
EUR 187

ESAM Rabbit pAb

A12210-100ul 100 ul
EUR 308

ESAM Rabbit pAb

A12210-200ul 200 ul
EUR 459

ESAM Rabbit pAb

A12210-20ul 20 ul
EUR 183

ESAM Rabbit pAb

A12210-50ul 50 ul
EUR 223

ESAM Polyclonal Antibody

ABP58502-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM cloning plasmid

CSB-CL850258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg
  • Show more
Description: A cloning plasmid for the ESAM gene.

ESAM Polyclonal Antibody

A55335 100 µg
EUR 570.55
Description: kits suitable for this type of research

ESAM Polyclonal Antibody

ES11142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Polyclonal Antibody

ES11142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- ESAM antibody

FNab02860 100µg
EUR 548.75
  • Immunogen: endothelial cell adhesion molecule
  • Uniprot ID: Q96AP7
  • Gene ID: 90952
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM

Anti-ESAM antibody

PAab02860 100 ug
EUR 386

Anti-ESAM antibody

STJ114102 100 µl
EUR 277

Anti-ESAM antibody

STJ192300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM

Anti-ESAM (1G8)

YF-MA19632 100 ug
EUR 363
Description: Mouse monoclonal to ESAM

Anti-ESAM (1E4)

YF-MA19633 100 ug
EUR 363
Description: Mouse monoclonal to ESAM


ELA-E0165r 96 Tests
EUR 886

PG-E2/ Rat PG- E2 ELISA Kit

ELA-E0538r 96 Tests
EUR 886

PG-E1/ Rat PG- E1 Elisa Kit

ELA-E0904r 96 Tests
EUR 886

Human versican/PG-M/PG-350 ELISA kit

CSB-E11884h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human versican/PG-M/PG-350 in samples from serum, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human versican/PG-M/PG-350 ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human versican/PG-M/PG-350 in samples from serum, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PG-9 maleate

B6435-10 10 mg
EUR 268

PG-9 maleate

B6435-50 50 mg
EUR 973

Progesterone (PG) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PG 01037 dihydrochloride

B7524-10 10 mg
EUR 258