
Mobile: 0032476375875

Lab Reagentia

Recente artiekels

Bezoek of bel ons


P2RY2 Antibody

33041-100ul 100ul
EUR 252

P2RY2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

P2RY2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

P2RY2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

P2RY2 Antibody

DF10259 200ul
EUR 304
Description: P2RY2 Antibody detects endogenous levels of total P2RY2.

P2RY2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY2 Antibody

ABD10259 100 ug
EUR 438

P2RY2 Rabbit pAb

A13923-100ul 100 ul
EUR 308

P2RY2 Rabbit pAb

A13923-200ul 200 ul
EUR 459

P2RY2 Rabbit pAb

A13923-20ul 20 ul
EUR 183

P2RY2 Rabbit pAb

A13923-50ul 50 ul
EUR 223

P2RY2 Blocking Peptide

DF10259-BP 1mg
EUR 195

P2RY2 Conjugated Antibody

C33041 100ul
EUR 397

P2RY2 cloning plasmid

CSB-CL017334HU1-10ug 10ug
EUR 427
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttct
  • Show more
Description: A cloning plasmid for the P2RY2 gene.

P2RY2 cloning plasmid

CSB-CL017334HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttct
  • Show more
Description: A cloning plasmid for the P2RY2 gene.

P2RY2 Rabbit pAb

A5779-100ul 100 ul
EUR 308

P2RY2 Rabbit pAb

A5779-200ul 200 ul
EUR 459

P2RY2 Rabbit pAb

A5779-20ul 20 ul
EUR 183

P2RY2 Rabbit pAb

A5779-50ul 50 ul
EUR 223

P2RY2 Polyclonal Antibody

ABP59789-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human P2RY2 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of P2RY2 from Human, Mouse, Rat. This P2RY2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY2 protein at amino acid sequence of 180-260

P2RY2 Polyclonal Antibody

ABP59789-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human P2RY2 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of P2RY2 from Human, Mouse, Rat. This P2RY2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY2 protein at amino acid sequence of 180-260

P2RY2 Polyclonal Antibody

ABP59789-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human P2RY2 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of P2RY2 from Human, Mouse, Rat. This P2RY2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY2 protein at amino acid sequence of 180-260

P2RY2 Polyclonal Antibody

ES11620-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P2RY2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RY2 Polyclonal Antibody

ES11620-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2RY2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-P2RY2 antibody

STJ28346 100 µl
EUR 277
Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene.

Anti-P2RY2 antibody

STJ115858 100 µl
EUR 277
Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene.

Anti-P2RY2 antibody

STJ13100215 100 µl
EUR 427

Anti-P2RY2 antibody

STJ13100227 100 µl
EUR 427

Anti-P2RY2 antibody

STJ13100228 100 µl
EUR 427

Anti-P2RY2 antibody

STJ192778 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to P2RY2


EF007399 96 Tests
EUR 689

Mouse P2RY2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat P2RY2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human P2RY2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RY2 Recombinant Protein (Human)

RP022366 100 ug Ask for price

P2RY2 Recombinant Protein (Human)

RP022369 100 ug Ask for price

P2RY2 Recombinant Protein (Mouse)

RP159800 100 ug Ask for price

P2RY2 Recombinant Protein (Rat)

RP219083 100 ug Ask for price

P2ry2 ORF Vector (Rat) (pORF)

ORF073029 1.0 ug DNA
EUR 506

P2RY2 ORF Vector (Human) (pORF)

ORF007456 1.0 ug DNA
EUR 95

P2RY2 ORF Vector (Human) (pORF)

ORF007457 1.0 ug DNA
EUR 95

P2ry2 ORF Vector (Mouse) (pORF)

ORF053268 1.0 ug DNA
EUR 506

P2RY2 ELISA Kit (Human) (OKCA01406)

OKCA01406 96 Wells
EUR 846
Description: Description of target: Receptor for ATP and UTP coupled to G-proteins that activate a phosphatidylinositol-calcium second messenger system. The affinity range is UTP = ATP > ATP-gamma-S >> 2-methylthio-ATP = ADP. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL

Polyclonal P2RY2 antibody - C-terminal region

APR12687G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY2 - C-terminal region. This antibody is tested and proven to work in the following applications:

P2ry2 sgRNA CRISPR Lentivector set (Rat)

K6823401 3 x 1.0 ug
EUR 339

P2ry2 sgRNA CRISPR Lentivector set (Mouse)

K3901901 3 x 1.0 ug
EUR 339

P2RY2 sgRNA CRISPR Lentivector set (Human)

K1582101 3 x 1.0 ug
EUR 339

Rabbit P2Y purinoceptor 2(P2RY2) ELISA kit

E04P0819-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit P2Y purinoceptor 2(P2RY2) ELISA kit

E04P0819-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit P2Y purinoceptor 2(P2RY2) ELISA kit

E04P0819-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat P2Y purinoceptor 2(P2RY2) ELISA kit

E02P0819-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat P2Y purinoceptor 2(P2RY2) ELISA kit

E02P0819-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.