OTOA

303  

OTOA siRNA
20-abx927444
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Otoancorin (OTOA) Antibody
abx026120-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Otoancorin (OTOA) Antibody
abx026120-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

OTOA cloning plasmid
CSB-CL017271HU-10ug 10ug
EUR 1214
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3420
  • Sequence: ATGTCTCAGGAACCTACGACATACTCCCTTTTCCTATTCCTTTTTCTGAGCCATGGAGTGTCGAGTTATACAGTGCCAAATTCCAGGCAGGATTTGCATCCATTGTTGCAAAACATGGCGGAAGAAATAATAGATGGAAGCTATCTGAATGCACTGCTGGATCTCATACAGTTTC
  • Show more
Description: A cloning plasmid for the OTOA gene.

Human OTOA shRNA Plasmid
20-abx965458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OTOA shRNA Plasmid
20-abx982809
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal OTOA Antibody (N-term)
APR14234G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OTOA (N-term). This antibody is tested and proven to work in the following applications:

Mouse Otoancorin, Otoa ELISA KIT
ELI-37019m 96 Tests
EUR 865

Human Otoancorin, OTOA ELISA KIT
ELI-37638h 96 Tests
EUR 824

OTOA ORF Vector (Human) (pORF)
ORF013986 1.0 ug DNA
EUR 354

Otoa ORF Vector (Mouse) (pORF)
ORF053199 1.0 ug DNA
EUR 506

Human Otoancorin(OTOA)ELISA Kit
QY-E04722 96T
EUR 394

Otoa sgRNA CRISPR Lentivector set (Mouse)
K3588401 3 x 1.0 ug
EUR 339

OTOA sgRNA CRISPR Lentivector set (Human)
K1576301 3 x 1.0 ug
EUR 339

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3588402 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3588403 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3588404 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 1)
K1576302 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 2)
K1576303 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 3)
K1576304 1.0 ug DNA
EUR 154

OTOA Protein Vector (Mouse) (pPB-C-His)
PV212794 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPB-N-His)
PV212795 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPM-C-HA)
PV212796 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPM-C-His)
PV212797 500 ng
EUR 1065

OTOA Protein Vector (Human) (pPB-C-His)
PV055941 500 ng
EUR 481

OTOA Protein Vector (Human) (pPB-N-His)
PV055942 500 ng
EUR 481

OTOA Protein Vector (Human) (pPM-C-HA)
PV055943 500 ng
EUR 481

OTOA Protein Vector (Human) (pPM-C-His)
PV055944 500 ng
EUR 481

Otoa 3'UTR Luciferase Stable Cell Line
TU115764 1.0 ml Ask for price

Otoa 3'UTR GFP Stable Cell Line
TU165764 1.0 ml Ask for price

Otoa 3'UTR GFP Stable Cell Line
TU265684 1.0 ml Ask for price

Otoa 3'UTR Luciferase Stable Cell Line
TU215684 1.0 ml Ask for price

OTOA 3'UTR GFP Stable Cell Line
TU067194 1.0 ml
EUR 1394

OTOA 3'UTR Luciferase Stable Cell Line
TU017194 1.0 ml
EUR 1394

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3588405 3 x 1.0 ug
EUR 376

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1576305 3 x 1.0 ug
EUR 376

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3588406 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3588407 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3588408 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1576306 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1576307 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1576308 1.0 ug DNA
EUR 167