NUP160

NUP160 antibody

70R-19002 50 ul
EUR 435
Description: Rabbit polyclonal NUP160 antibody

NUP160 Antibody

DF4251 200ul
EUR 304
Description: NUP160 Antibody detects endogenous levels of total NUP160.

NUP160 Antibody

1-CSB-PA016192GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NUP160. Recognizes NUP160 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUP160 antibody

70R-50890 100 ul
EUR 244
Description: Purified Polyclonal NUP160 antibody

NUP160 Antibody

1-CSB-PA008350
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUP160. Recognizes NUP160 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NUP160 siRNA

20-abx926621
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP160 siRNA

20-abx926622
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP160 Antibody

ABD4251 100 ug
EUR 438

NUP160 Rabbit pAb

A13080-100ul 100 ul
EUR 308

NUP160 Rabbit pAb

A13080-200ul 200 ul
EUR 459

NUP160 Rabbit pAb

A13080-20ul 20 ul
EUR 183

NUP160 Rabbit pAb

A13080-50ul 50 ul
EUR 223

Anti-Nup160 Antibody

A05629 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Nup160 Antibody (NUP160) detection. Tested with WB in Human, Mouse.

Nup160 Polyclonal Antibody

41259-100ul 100ul
EUR 252

Nup160 Polyclonal Antibody

41259-50ul 50ul
EUR 187

NUP160 Blocking Peptide

DF4251-BP 1mg
EUR 195

NUP160 Blocking Peptide

20-abx063765
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Polyclonal NUP160 Antibody

APR06491G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP160 . This antibody is tested and proven to work in the following applications:

NUP160 cloning plasmid

CSB-CL614254HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atggcggcggcgggagccctggaacggagcttcgtggagctaagcggagctgagcgcgaaaggccgaggcactttcgggaattcacagtctgcagcattgggactgcaaatgccgtggctggcgccgtaaaatacagtgaaagcgcgggaggcttttactacgtggagagtggcaa
  • Show more
Description: A cloning plasmid for the NUP160 gene.

NUP160 cloning plasmid

CSB-CL614254HU2-10ug 10ug
EUR 1687
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4311
  • Sequence: ATGCTTCACCTGTCCGCAGCTCCGCCCGCCCCACCCCCGGAAGTGACGGCGACCGCGCGGCCCTGCCTTTGTTCCGTTGGGCGTCGCGGCGACGGCGGGAAGATGGCGGCGGCGGGAGCCCTGGAACGGAGCTTCGTGGAGCTAAGCGGAGCTGAGCGCGAAAGGCCGAGGCACT
  • Show more
Description: A cloning plasmid for the NUP160 gene.

Nup160 Polyclonal Antibody

ABP54328-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of Nup160 from Human, Mouse. This Nup160 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450

Nup160 Polyclonal Antibody

ABP54328-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of Nup160 from Human, Mouse. This Nup160 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450

Nup160 Polyclonal Antibody

ABP54328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of Nup160 from Human, Mouse. This Nup160 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450

NUP160 Rabbit pAb

A9161-100ul 100 ul
EUR 308

NUP160 Rabbit pAb

A9161-200ul 200 ul
EUR 459

NUP160 Rabbit pAb

A9161-20ul 20 ul
EUR 183

NUP160 Rabbit pAb

A9161-50ul 50 ul Ask for price

anti- NUP160 antibody

FNab05922 100µg
EUR 548.75
  • Immunogen: nucleoporin 160kDa
  • Uniprot ID: Q12769
  • Gene ID: 23279
  • Research Area: Metabolism
Description: Antibody raised against NUP160

Nup160 Polyclonal Antibody

ES5327-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nup160 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nup160 Polyclonal Antibody

ES5327-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nup160 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-NUP160 antibody

PAab05922 100 ug
EUR 386

Anti-NUP160 antibody

STJ111592 100 µl
EUR 277

Anti-NUP160 antibody

STJ115047 100 µl
EUR 277

Anti-Nup160 antibody

STJ94576 200 µl
EUR 197
Description: Nup160 is a protein encoded by the NUP160 gene which is approximately 162,1 kDa. Nup160 is localised to the nucleus and is involved in the transport of the SLBP independent mature mRNA, the HIV life cycle, cell cycle and influenza viral RNA transcription and replication. NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport and is involved in polyA RNA transport. NUp160 is expressed in the bone marrow, intestine, liver, muscle and skin. STJ94576 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of Nup160 protein.

Mouse Nuclear pore complex protein Nup160, Nup160 ELISA KIT

ELI-21357m 96 Tests
EUR 865

Human Nuclear pore complex protein Nup160, NUP160 ELISA KIT

ELI-38240h 96 Tests
EUR 824

Polyclonal NUP160 Antibody (Center)

APR03617G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP160 (Center). This antibody is tested and proven to work in the following applications:

Nucleoporin 160 (NUP160) Antibody

20-abx008246
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

abx026445-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

abx026445-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

20-abx124217
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Human NUP160 ELISA Kit

EHN0059 96Tests
EUR 521

Bovine NUP160 ELISA Kit

EBN0059 96Tests
EUR 521

Anserine NUP160 ELISA Kit

EAN0059 96Tests
EUR 521

Canine NUP160 ELISA Kit

ECN0059 96Tests
EUR 521

Goat NUP160 ELISA Kit

EGTN0059 96Tests
EUR 521

NUP160 ELISA KIT|Human

EF001387 96 Tests
EUR 689

Mouse NUP160 shRNA Plasmid

20-abx975145
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Nup160 Polyclonal Conjugated Antibody

C41259 100ul
EUR 397

Nucleoporin 160 (NUP160) Antibody

abx235922-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human NUP160 shRNA Plasmid

20-abx958147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine NUP160 ELISA Kit

EPN0059 96Tests
EUR 521

Rat NUP160 ELISA Kit

ERN0059 96Tests
EUR 521

Rabbit NUP160 ELISA Kit

ERTN0059 96Tests
EUR 521

Mouse NUP160 ELISA Kit

EMN0059 96Tests
EUR 521

Recombinant Nucleoporin 160kDa (NUP160)

4-RPB188Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.3kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Nucleoporin 160kDa expressed in: E.coli

Recombinant Nucleoporin 160kDa (NUP160)

4-RPB188Mu01
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z0W3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.2kDa
  • Isoelectric Point: 6.7
Description: Recombinant Mouse Nucleoporin 160kDa expressed in: E.coli

Nucleoporin 160 kDa (NUP160) Antibody

20-abx102039
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 160 kDa (NUP160) Antibody

20-abx102040
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 160 kDa (NUP160) Antibody

20-abx114226
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guinea Pig NUP160 ELISA Kit

EGN0059 96Tests
EUR 521

Nucleoporin 160 kDa (NUP160) Antibody

20-abx325509
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nup160 ORF Vector (Rat) (pORF)

ORF071615 1.0 ug DNA
EUR 2080

NUP160 ORF Vector (Human) (pORF)

ORF013928 1.0 ug DNA
EUR 95

NUP160 ORF Vector (Human) (pORF)

ORF007303 1.0 ug DNA
EUR 95

Nup160 ORF Vector (Mouse) (pORF)

ORF051824 1.0 ug DNA
EUR 506

NUP160 ELISA Kit (Mouse) (OKEI00494)

OKEI00494 96 Wells
EUR 767
Description: Description of target: Involved in poly(A)+ RNA transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Mouse Nucleoporin 160 kDa (NUP160) Protein

20-abx068358
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse NUP160(Nucleoporin 160kDa) ELISA Kit

EM1247 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Z0W3
  • Alias: NUP160/Nuclear pore complex protein Nup160/Nucleoporin Nup160/160 kDa nucleoporin/Gene trap locus 1-13 protein(GTL-13)/
Description: Method of detection: Double Antibody, Sandwich ELISA ;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Nup160 sgRNA CRISPR Lentivector set (Rat)

K6586401 3 x 1.0 ug
EUR 339

NUP160 sgRNA CRISPR Lentivector set (Human)

K1469201 3 x 1.0 ug
EUR 339

Human Nucleoporin 160kDa(NUP160)ELISA Kit

QY-E05259 96T
EUR 361

CLIA kit for Mouse NUP160 (Nucleoporin 160kDa)

E-CL-M0523 1 plate of 96 wells
EUR 584
  • Gentaur's NUP160 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP160 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse NUP160 (Nucleoporin 160kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse NUP160 (Nucleoporin 160kDa)

E-EL-M0850 1 plate of 96 wells
EUR 534
  • Gentaur's NUP160 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP160. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse NUP160 (Nucleoporin 160kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat NUP160 (Nucleoporin 160kDa)

E-EL-R0680 1 plate of 96 wells
EUR 534
  • Gentaur's NUP160 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat NUP160. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat NUP160 (Nucleoporin 160kDa) in samples from Serum, Plasma, Cell supernatant

Mouse Nucleoporin 160 kDa (NUP160) CLIA Kit

abx197369-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Nucleoporin 160 kDa (NUP160) ELISA Kit

abx254304-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Monkey Nucleoporin 160 kDa (NUP160) ELISA Kit

abx359881-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Nucleoporin 160 kDa (NUP160) ELISA Kit

abx361587-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Nucleoporin 160 kDa (NUP160) ELISA Kit

abx363253-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Nucleoporin 160 kDa (NUP160) ELISA Kit

abx353807-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Nucleoporin 160 kDa (NUP160) ELISA Kit

abx356738-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Nucleoporin 160 kDa (NUP160) ELISA Kit

abx381930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nup160 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6586402 1.0 ug DNA
EUR 154

Nup160 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6586403 1.0 ug DNA
EUR 154

Nup160 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6586404 1.0 ug DNA
EUR 154

NUP160 sgRNA CRISPR Lentivector (Human) (Target 1)

K1469202 1.0 ug DNA
EUR 154

NUP160 sgRNA CRISPR Lentivector (Human) (Target 2)

K1469203 1.0 ug DNA
EUR 154

NUP160 sgRNA CRISPR Lentivector (Human) (Target 3)

K1469204 1.0 ug DNA
EUR 154

Nucleoporin 160kDa (NUP160) Polyclonal Antibody (Human, Mouse)

4-PAB188Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP160 (Phe11~Val206)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Nucleoporin 160kDa (NUP160)

NUP160 Protein Vector (Rat) (pPB-C-His)

PV286458 500 ng
EUR 2354

NUP160 Protein Vector (Rat) (pPB-N-His)

PV286459 500 ng
EUR 2354

NUP160 Protein Vector (Rat) (pPM-C-HA)

PV286460 500 ng
EUR 2354

NUP160 Protein Vector (Rat) (pPM-C-His)

PV286461 500 ng
EUR 2354

NUP160 Protein Vector (Mouse) (pPB-C-His)

PV207294 500 ng
EUR 603