Human Mucin 20 (MUC20) ELISA Kit

DLR-MUC20-Hu-96T 96T
EUR 621
  • Should the Human Mucin 20 (MUC20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 20 (MUC20) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mucin 20 (MUC20) ELISA Kit

RDR-MUC20-Hu-48Tests 48 Tests
EUR 500

Human Mucin 20 (MUC20) ELISA Kit

RDR-MUC20-Hu-96Tests 96 Tests
EUR 692

Human Mucin 20 (MUC20) ELISA Kit

RD-MUC20-Hu-48Tests 48 Tests
EUR 478

Human Mucin 20 (MUC20) ELISA Kit

RD-MUC20-Hu-96Tests 96 Tests
EUR 662

MUC20 antibody

70R-18679 50 ul
EUR 435
Description: Rabbit polyclonal MUC20 antibody

MUC20 Antibody

35824-100ul 100ul
EUR 252

MUC20 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

MUC20 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MUC20 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

MUC20 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22688 50 ug
EUR 363
Description: Mouse polyclonal to MUC20


YF-PA22689 100 ug
EUR 403
Description: Rabbit polyclonal to MUC20

Anti-MUC20 Antibody

A07372 100ug/vial
EUR 334

MUC20 Rabbit pAb

A15968-100ul 100 ul
EUR 308

MUC20 Rabbit pAb

A15968-200ul 200 ul
EUR 459

MUC20 Rabbit pAb

A15968-20ul 20 ul
EUR 183

MUC20 Rabbit pAb

A15968-50ul 50 ul
EUR 223

MUC20 Conjugated Antibody

C35824 100ul
EUR 397

MUC20 cloning plasmid

CSB-CL822693HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1668
  • Sequence: atgggctgtctctggggtctggctctgccccttttcttcttctgctgggaggttggggtctctgggagctctgcaggccccagcacccgcagagcagacactgcgatgacaacggacgacacagaagtgcccgctatgactctagcaccgggccacgccgctctggaaactcaaa
  • Show more
Description: A cloning plasmid for the MUC20 gene.

MUC20 cloning plasmid

CSB-CL822693HU2-10ug 10ug
EUR 562
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1617
  • Sequence: atgggctgtctctggggtctggctctgccccttttcttcttctgctgggaggttggggtctctgggagctctgcaggccccagcacccgcagagcagacactgcgatgacaacggacgacacagaagtgcccgctatgactctagcaccgggccacgccgctctggaaactcaaa
  • Show more
Description: A cloning plasmid for the MUC20 gene.

MUC20 Polyclonal Antibody

A69063 100 ?g
EUR 628.55
Description: Ask the seller for details

MUC20 Rabbit pAb

A2766-100ul 100 ul
EUR 308

MUC20 Rabbit pAb

A2766-200ul 200 ul
EUR 459

MUC20 Rabbit pAb

A2766-20ul 20 ul Ask for price

MUC20 Rabbit pAb

A2766-50ul 50 ul
EUR 223

Anti-MUC20 antibody

PAab05431 100 ug
EUR 412

pDONR223-MUC20 Plasmid

PVTB00557 2 ug
EUR 356


PVT19046 2 ug
EUR 231

Anti-MUC20 antibody

STJ24644 100 µl
EUR 277
Description: This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified.

Anti-MUC20 antibody

STJ118427 100 µl
EUR 277

MUC20 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MUC20 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MUC20 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mucin 20 (MUC20) Antibody

abx025133-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

abx025133-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

abx025134-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

abx025134-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 20 (MUC20) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 20 (MUC20) Antibody

  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 20 (MUC20) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mucin 20 (MUC20) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human MUC20 ELISA Kit

ELA-E1087h 96 Tests
EUR 824


EF002906 96 Tests
EUR 689

Human MUC20 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mucin 20 (MUC20) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody

abx235431-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mucin 20 (MUC20) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse MUC20 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mucin 20 (MUC20) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Mucin 20 (MUC20)

  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B2RZ35
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Mucin 20 expressed in: E.coli

MUC20 Recombinant Protein (Human)

RP020386 100 ug Ask for price

MUC20 Recombinant Protein (Human)

RP020389 100 ug Ask for price

MUC20 Recombinant Protein (Mouse)

RP152240 100 ug Ask for price

MUC20 Recombinant Protein (Mouse)

RP152243 100 ug Ask for price

MUC20 Recombinant Protein (Rat)

RP212774 100 ug Ask for price

Rat Mucin 20 (MUC20) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polyclonal MUC20 Antibody (C-term)

APR14363G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUC20 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal MUC20 Antibody (N-term)

APR14295G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUC20 (N-term). This antibody is tested and proven to work in the following applications:

Mucin 20 (MUC20) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mucin 20 (MUC20) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Mucin 20 (MUC20) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

MUC20 Polyclonal Antibody, HRP Conjugated

A69064 100 ?g
EUR 628.55
Description: The best epigenetics products

MUC20 Polyclonal Antibody, FITC Conjugated

A69065 100 ?g
EUR 628.55
Description: kits suitable for this type of research

MUC20 Polyclonal Antibody, Biotin Conjugated

A69066 100 ?g
EUR 628.55
Description: fast delivery possible

Muc20 ORF Vector (Rat) (pORF)

ORF070926 1.0 ug DNA
EUR 506

MUC20 ORF Vector (Human) (pORF)

ORF006796 1.0 ug DNA
EUR 95

MUC20 ORF Vector (Human) (pORF)

ORF006797 1.0 ug DNA
EUR 95

Muc20 ORF Vector (Mouse) (pORF)

ORF050748 1.0 ug DNA
EUR 506

Muc20 ORF Vector (Mouse) (pORF)

ORF050749 1.0 ug DNA
EUR 506

MUC20 ELISA Kit (Human) (OKCD07045)

OKCD07045 96 Wells
EUR 753
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

MUC20 ELISA Kit (Mouse) (OKEH05697)

OKEH05697 96 Wells
EUR 662
Description: Description of target: May regulate MET signaling cascade. Seems to decrease hepatocyte growth factor (HGF)-induced transient MAPK activation. Blocks GRB2 recruitment to MET thus suppressing the GRB2-RAS pathway. Inhibits HGF-induced proliferation of MMP1 and MMP9 expression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.404 ng/mL

MUC20 ELISA Kit (Pig) (OKWB00323)

OKWB00323 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

MUC20 ELISA Kit (Human) (OKEH04441)

OKEH04441 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL

Human Mucin 20 (MUC20) CLIA Kit

abx196056-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Mucin 20 (MUC20) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Mucin 20 (MUC20) ELISA Kit

abx255532-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Mucin 20 (MUC20) ELISA Kit

abx250484-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human MUC20/ Mucin-20 ELISA Kit

E1670Hu 1 Kit
EUR 571

Human MUC20(Mucin-20) ELISA Kit

EH1227 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8N307
  • Alias: MUC20(Mucin-20)/MUC-20
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Mucin- 20, Muc20 ELISA KIT

ELI-03543m 96 Tests
EUR 865

Human Mucin- 20, MUC20 ELISA KIT

ELI-03544h 96 Tests
EUR 824

Monkey Mucin 20 (MUC20) ELISA Kit

abx358707-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Mucin 20 (MUC20) ELISA Kit

abx355816-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Mucin 20 (MUC20) ELISA Kit

abx363658-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Mucin 20 (MUC20) ELISA Kit

abx571306-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Mucin 20 (MUC20) ELISA Kit

abx515141-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin 20 (MUC20) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Muc20 sgRNA CRISPR Lentivector set (Rat)

K6709201 3 x 1.0 ug
EUR 339