Western Blot antibodies to the MPDU1 Gene

Rabbit Polyclonals

MPDU1 siRNA
20-abx924439	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MPDU1 Antibody (HRP)
20-abx304518	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MPDU1 Antibody (FITC)
20-abx304519	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MPDU1 Antibody (Biotin)
20-abx304520	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MPDU1 cloning plasmid
CSB-CL014744HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 744 Sequence: atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagct Show more
Description: A cloning plasmid for the MPDU1 gene.

MPDU1 Polyclonal Antibody
A62970	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

MPDU1 Antibody, HRP conjugated
1-CSB-PA014744LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPDU1 Antibody, FITC conjugated
1-CSB-PA014744LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPDU1 Antibody, Biotin conjugated
1-CSB-PA014744LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human MPDU1 ELISA KIT
ELI-14234h	Lifescience Market	96 Tests	EUR 824

Mouse Mpdu1 ELISA KIT
ELI-16579m	Lifescience Market	96 Tests	EUR 865

Human MPDU1 shRNA Plasmid
20-abx956331	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MPDU1 Recombinant Protein (Human)
RP019753	ABM	100 ug	Ask for price

MPDU1 Recombinant Protein (Mouse)
RP151229	ABM	100 ug	Ask for price

MPDU1 Recombinant Protein (Rat)
RP212120	ABM	100 ug	Ask for price

MPDU1 Polyclonal Antibody, HRP Conjugated
A62971	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MPDU1 Polyclonal Antibody, FITC Conjugated
A62972	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MPDU1 Polyclonal Antibody, Biotin Conjugated
A62973	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Mpdu1 ORF Vector (Rat) (pORF)
ORF070708	ABM	1.0 ug DNA	EUR 506

MPDU1 ORF Vector (Human) (pORF)
ORF006585	ABM	1.0 ug DNA	EUR 95

Mpdu1 ORF Vector (Mouse) (pORF)
ORF050411	ABM	1.0 ug DNA	EUR 506

Mpdu1 sgRNA CRISPR Lentivector set (Rat)
K6170601	ABM	3 x 1.0 ug	EUR 339

MPDU1 sgRNA CRISPR Lentivector set (Human)
K1319501	ABM	3 x 1.0 ug	EUR 339

Mpdu1 sgRNA CRISPR Lentivector set (Mouse)
K4472301	ABM	3 x 1.0 ug	EUR 339

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6170602	ABM	1.0 ug DNA	EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6170603	ABM	1.0 ug DNA	EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6170604	ABM	1.0 ug DNA	EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1319502	ABM	1.0 ug DNA	EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1319503	ABM	1.0 ug DNA	EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1319504	ABM	1.0 ug DNA	EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4472302	ABM	1.0 ug DNA	EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4472303	ABM	1.0 ug DNA	EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4472304	ABM	1.0 ug DNA	EUR 154

MPDU1 Protein Vector (Mouse) (pPB-C-His)
PV201642	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Mouse) (pPB-N-His)
PV201643	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-HA)
PV201644	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-His)
PV201645	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Rat) (pPB-C-His)
PV282830	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Rat) (pPB-N-His)
PV282831	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-HA)
PV282832	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-His)
PV282833	ABM	500 ng	EUR 603

MPDU1 Protein Vector (Human) (pPB-C-His)
PV026337	ABM	500 ng	EUR 329

MPDU1 Protein Vector (Human) (pPB-N-His)
PV026338	ABM	500 ng	EUR 329

MPDU1 Protein Vector (Human) (pPM-C-HA)
PV026339	ABM	500 ng	EUR 329

MPDU1 Protein Vector (Human) (pPM-C-His)
PV026340	ABM	500 ng	EUR 329

Mpdu1 3'UTR Luciferase Stable Cell Line
TU113346	ABM	1.0 ml	Ask for price

Mpdu1 3'UTR GFP Stable Cell Line
TU163346	ABM	1.0 ml	Ask for price

Mpdu1 3'UTR Luciferase Stable Cell Line
TU213328	ABM	1.0 ml	Ask for price

Mpdu1 3'UTR GFP Stable Cell Line
TU263328	ABM	1.0 ml	Ask for price

MPDU1 3'UTR GFP Stable Cell Line
TU064467	ABM	1.0 ml	EUR 1394

MPDU1 3'UTR Luciferase Stable Cell Line
TU014467	ABM	1.0 ml	EUR 1394

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody
abx031453-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody
abx031453-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody
20-abx301940	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6170605	ABM	3 x 1.0 ug	EUR 376

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1319505	ABM	3 x 1.0 ug	EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4472305	ABM	3 x 1.0 ug	EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6170606	ABM	1.0 ug DNA	EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6170607	ABM	1.0 ug DNA	EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6170608	ABM	1.0 ug DNA	EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1319506	ABM	1.0 ug DNA	EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1319507	ABM	1.0 ug DNA	EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1319508	ABM	1.0 ug DNA	EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4472306	ABM	1.0 ug DNA	EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4472307	ABM	1.0 ug DNA	EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4472308	ABM	1.0 ug DNA	EUR 167

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)
KTE70984-48T	Abbkine	48T	EUR 332
Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)
KTE70984-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)
KTE70984-96T	Abbkine	96T	EUR 539
Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)
KTE61570-48T	Abbkine	48T	EUR 332
MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)
KTE61570-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)
KTE61570-96T	Abbkine	96T	EUR 539
MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.