MCFD2

MCFD2 Protein

20-abx260565
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

MCFD2 siRNA

20-abx903188
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCFD2 siRNA

20-abx923719
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCFD2 siRNA

20-abx923720
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MCFD2

YF-PA21650 50 ul
EUR 363
Description: Mouse polyclonal to MCFD2

anti-MCFD2

YF-PA26773 50 ul
EUR 334
Description: Mouse polyclonal to MCFD2

MCFD2 Rabbit pAb

A10376-100ul 100 ul
EUR 308

MCFD2 Rabbit pAb

A10376-200ul 200 ul
EUR 459

MCFD2 Rabbit pAb

A10376-20ul 20 ul
EUR 183

MCFD2 Rabbit pAb

A10376-50ul 50 ul
EUR 223

MCFD2 Blocking Peptide

20-abx161155
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MCFD2 Conjugated Antibody

C47337 100ul
EUR 397

MCFD2 cloning plasmid

CSB-CL847752HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atgaccatgagatccctgctcagaacccccttcctgtgtggcctgctctgggccttttgtgccccaggcgccagggctgaggagcctgcagccagcttctcccaacccggcagcatgggcctggataagaacacagtgcacgaccaagagcatatcatggagcatctagaaggtgt
  • Show more
Description: A cloning plasmid for the MCFD2 gene.

pENTR223-MCFD2 vector

PVT11754 2 ug
EUR 304

Anti-MCFD2 antibody

STJ112412 100 µl
EUR 277
Description: This gene encodes a soluble luminal protein with two calmodulin-like EF-hand motifs at its C-terminus. This protein forms a complex with LMAN1 (lectin mannose binding protein 1; also known as ERGIC-53) that facilitates the transport of coagulation factors V (FV) and VIII (FVIII) from the endoplasmic reticulum to the Golgi apparatus via an endoplasmic reticulum Golgi intermediate compartment (ERGIC). Mutations in this gene cause combined deficiency of FV and FVIII (F5F8D); a rare autosomal recessive bleeding disorder characterized by mild to moderate bleeding and coordinate reduction in plasma FV and FVIII levels. This protein has also been shown to maintain stem cell potential in adult central nervous system and is a marker for testicular germ cell tumors. The 3' UTR of this gene contains a transposon-like human repeat element named 'THE 1'. A processed RNA pseudogene of this gene is on chromosome 6p22.1. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

MCFD2 protein (T7 tag)

80R-1240 100 ug
EUR 268
Description: Purified recombinant Human MCFD2 protein (T7 tag)

Human MCFD2 ELISA Kit

ELA-E15072h 96 Tests
EUR 824

MCFD2 ELISA KIT|Human

EF005889 96 Tests
EUR 689

Rat MCFD2 shRNA Plasmid

20-abx987933
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MCFD2 shRNA Plasmid

20-abx963942
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MCFD2 shRNA Plasmid

20-abx980461
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCFD2 Recombinant Protein (Human)

RP018970 100 ug Ask for price

MCFD2 Recombinant Protein (Mouse)

RP149807 100 ug Ask for price

MCFD2 Recombinant Protein (Mouse)

RP149810 100 ug Ask for price

MCFD2 Recombinant Protein (Rat)

RP211106 100 ug Ask for price

Anti-MCFD2 (3A5-G4)

YF-MA11713 100 ug
EUR 363
Description: Mouse monoclonal to MCFD2

Monoclonal MCFD2 Antibody, Clone: 165CT13.1.6

APR17335G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MCFD2. The antibodies are raised in Mouse and are from clone 165CT13.1.6. This antibody is applicable in WB, E

Mcfd2 ORF Vector (Rat) (pORF)

ORF070370 1.0 ug DNA
EUR 506

MCFD2 ORF Vector (Human) (pORF)

ORF006324 1.0 ug DNA
EUR 95

Mcfd2 ORF Vector (Mouse) (pORF)

ORF049937 1.0 ug DNA
EUR 506

Mcfd2 ORF Vector (Mouse) (pORF)

ORF049938 1.0 ug DNA
EUR 506

MCFD2 ELISA Kit (Human) (OKEH02484)

OKEH02484 96 Wells
EUR 779
Description: Description of target: This gene encodes a soluble luminal protein with two calmodulin-like EF-hand motifs at its C-terminus. This protein forms a complex with LMAN1 (lectin mannose binding protein 1; also known as ERGIC-53) that facilitates the transport of coagulation factors V (FV) and VIII (FVIII) from the endoplasmic reticulum to the Golgi apparatus via an endoplasmic reticulum Golgi intermediate compartment (ERGIC). Mutations in this gene cause combined deficiency of FV and FVIII (F5F8D); a rare autosomal recessive bleeding disorder characterized by mild to moderate bleeding and coordinate reduction in plasma FV and FVIII levels. This protein has also been shown to maintain stem cell potential in adult central nervous system and is a marker for testicular germ cell tumors. The 3' UTR of this gene contains a transposon-like human repeat element named 'THE 1'. A processed RNA pseudogene of this gene is on chromosome 6p22.1. Alternative splicing results in multiple transcript variants encoding distinct isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 13 pg/mL

MCFD2 ELISA Kit (Mouse) (OKEH03666)

OKEH03666 96 Wells
EUR 779
Description: Description of target: The MCFD2-LMAN1 complex forms a specific cargo receptor for the ER-to-Golgi transport of selected proteins.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.63 pg/mL

Mcfd2 sgRNA CRISPR Lentivector set (Rat)

K7334001 3 x 1.0 ug
EUR 339

MCFD2 sgRNA CRISPR Lentivector set (Human)

K1279401 3 x 1.0 ug
EUR 339

Mcfd2 sgRNA CRISPR Lentivector set (Mouse)

K4500801 3 x 1.0 ug
EUR 339

Mcfd2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7334002 1.0 ug DNA
EUR 154

Mcfd2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7334003 1.0 ug DNA
EUR 154

Mcfd2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7334004 1.0 ug DNA
EUR 154

MCFD2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1279402 1.0 ug DNA
EUR 154

MCFD2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1279403 1.0 ug DNA
EUR 154

MCFD2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1279404 1.0 ug DNA
EUR 154

Mcfd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4500802 1.0 ug DNA
EUR 154

Mcfd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4500803 1.0 ug DNA
EUR 154

Mcfd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4500804 1.0 ug DNA
EUR 154

MCFD2 Protein Vector (Human) (pPB-C-His)

PV025293 500 ng
EUR 329

MCFD2 Protein Vector (Human) (pPB-N-His)

PV025294 500 ng
EUR 329

MCFD2 Protein Vector (Human) (pPM-C-HA)

PV025295 500 ng
EUR 329

MCFD2 Protein Vector (Human) (pPM-C-His)

PV025296 500 ng
EUR 329

MCFD2 Protein Vector (Rat) (pPB-C-His)

PV281478 500 ng
EUR 603

MCFD2 Protein Vector (Rat) (pPB-N-His)

PV281479 500 ng
EUR 603

MCFD2 Protein Vector (Rat) (pPM-C-HA)

PV281480 500 ng
EUR 603

MCFD2 Protein Vector (Rat) (pPM-C-His)

PV281481 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPB-C-His)

PV199746 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPB-N-His)

PV199747 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPM-C-HA)

PV199748 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPM-C-His)

PV199749 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPB-C-His)

PV199750 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPB-N-His)

PV199751 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPM-C-HA)

PV199752 500 ng
EUR 603

MCFD2 Protein Vector (Mouse) (pPM-C-His)

PV199753 500 ng
EUR 603

Recombinant Human MCFD2 Protein, Untagged, E.coli-1mg

QP12660-1mg 1mg
EUR 2312

Recombinant Human MCFD2 Protein, Untagged, E.coli-25ug

QP12660-25ug 25ug
EUR 201

Recombinant Human MCFD2 Protein, Untagged, E.coli-5ug

QP12660-5ug 5ug
EUR 155

Mcfd2 3'UTR Luciferase Stable Cell Line

TU112991 1.0 ml Ask for price

Mcfd2 3'UTR GFP Stable Cell Line

TU162991 1.0 ml Ask for price

Mcfd2 3'UTR Luciferase Stable Cell Line

TU212957 1.0 ml Ask for price

Mcfd2 3'UTR GFP Stable Cell Line

TU262957 1.0 ml Ask for price

MCFD2 3'UTR GFP Stable Cell Line

TU063114 1.0 ml
EUR 2333

MCFD2 3'UTR Luciferase Stable Cell Line

TU013114 1.0 ml
EUR 2333

Multiple Coagulation Factor Deficiency Protein 2 (MCFD2) Antibody

abx025215-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Multiple Coagulation Factor Deficiency Protein 2 (MCFD2) Antibody

abx025215-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Multiple Coagulation Factor Deficiency Protein 2 (MCFD2) Antibody

20-abx121155
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Multiple Coagulation Factor Deficiency Protein 2 (MCFD2) Antibody

20-abx126138
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCFD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV675511 1.0 ug DNA
EUR 514

MCFD2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV675515 1.0 ug DNA
EUR 514

MCFD2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV675516 1.0 ug DNA
EUR 514

Human Multiple coagulation factor deficiency protein 2, MCFD2 EL

ELI-23699h 96 Tests
EUR 824

Mcfd2 ELISA Kit| Rat Multiple coagulation factor deficiency pro

EF018995 96 Tests
EUR 689

Mcfd2 ELISA Kit| Mouse Multiple coagulation factor deficiency pr

EF013262 96 Tests
EUR 689

MCFD2 Multiple Coagulation Factor Deficiency 2 Human Recombinant Protein

PROTQ8NI22 Regular: 25ug
EUR 317
Description: MCFD2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 136 amino acids (27-146 a.a.) and having a molecular wieght of 20.9kDa._x000D_ The MCFD2 is is fused to 16 a.a. T7-Tag at N-terminus and purified by proprietary chromatographic techniques.

Mouse Multiple coagulation factor deficiency protein 2 (MCFD2) ELISA Kit

abx254996-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Multiple coagulation factor deficiency protein 2 (MCFD2) ELISA Kit

abx251055-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human MCFD2/ Multiple coagulation factor deficiency protein 2 ELISA Kit

E1567Hu 1 Kit
EUR 605

Human MCFD2(Multiple coagulation factor deficiency protein 2) ELISA Kit

EH1751 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q8NI22
  • Alias: MCFD2/Multiple coagulation factor deficiency protein 2/Neural stem cell-derived neuronal survival protein/SDNSF
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Rat Multiple coagulation factor deficiency protein 2 (MCFD2) ELISA Kit

abx517601-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mcfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7334005 3 x 1.0 ug
EUR 376

MCFD2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1279405 3 x 1.0 ug
EUR 376

Mcfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4500805 3 x 1.0 ug
EUR 376

Rat Mcfd2/ Multiple coagulation factor deficiency protein 2 homolog ELISA Kit

E0605Ra 1 Kit
EUR 646

Mouse Mcfd2/ Multiple coagulation factor deficiency protein 2 homolog ELISA Kit

E0935Mo 1 Kit
EUR 632

Mouse Mcfd2(Multiple coagulation factor deficiency protein 2 homolog) ELISA Kit

EM0645 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: Q8K5B2
  • Alias: Mcfd2/Neural stem cell-derived neuronal survival protein/SDNSF
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

MCFD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV675512 1.0 ug DNA
EUR 514

MCFD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV675513 1.0 ug DNA
EUR 572

MCFD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV675514 1.0 ug DNA
EUR 572