LYPD4

LYPD4 siRNA

20-abx923179
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYPD4 antibody

70R-5455 50 ug
EUR 467
Description: Rabbit polyclonal LYPD4 antibody raised against the N terminal of LYPD4

LYPD4 Antibody

42972-100ul 100ul
EUR 252

LYPD4 Antibody

1-CSB-PA751011LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYPD4. Recognizes LYPD4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

pENTR223- LYPD4

PVT10084 2 ug
EUR 266

LYPD4 Conjugated Antibody

C42972 100ul
EUR 397

LYPD4 Antibody (HRP)

20-abx307929
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LYPD4 Antibody (FITC)

20-abx307930
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LYPD4 Antibody (Biotin)

20-abx307931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LYPD4 Polyclonal Antibody

A59702 100 µg
EUR 570.55
Description: kits suitable for this type of research

LYPD4 Blocking Peptide

33R-6059 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYPD4 antibody, catalog no. 70R-5455

LYPD4 cloning plasmid

CSB-CL751011HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 636
  • Sequence: atgggaccccagcatttgagacttgtgcagctgttctgccttctaggggccatctccactctgcctcgtatgtcctgtggggctggatgctataagacccagaaagggactgcaaggggagtcgtgggctttaaaggctgcagctcgtcttcgtcttaccctgcgcaaatctccta
  • Show more
Description: A cloning plasmid for the LYPD4 gene.

Human LYPD4 shRNA Plasmid

20-abx965537
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LYPD4 shRNA Plasmid

20-abx982009
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LYPD4 Antibody, HRP conjugated

1-CSB-PA751011LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYPD4. Recognizes LYPD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LYPD4 Antibody, FITC conjugated

1-CSB-PA751011LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYPD4. Recognizes LYPD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LYPD4 Antibody, Biotin conjugated

1-CSB-PA751011LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYPD4. Recognizes LYPD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LYPD4 Recombinant Protein (Human)

RP018469 100 ug Ask for price

LYPD4 Recombinant Protein (Rat)

RP210416 100 ug Ask for price

pECMV-3-FLAG-LYPD4

PVT12343 2 ug
EUR 703

LYPD4 Recombinant Protein (Mouse)

RP148766 100 ug Ask for price

LYPD4 Polyclonal Antibody, Biotin Conjugated

A59703 100 µg
EUR 570.55
Description: fast delivery possible

LYPD4 Polyclonal Antibody, FITC Conjugated

A59704 100 µg
EUR 570.55
Description: reagents widely cited

LYPD4 Polyclonal Antibody, HRP Conjugated

A59705 100 µg
EUR 570.55
Description: Ask the seller for details

LYPD4 ORF Vector (Human) (pORF)

ORF006157 1.0 ug DNA
EUR 95

Lypd4 ORF Vector (Mouse) (pORF)

ORF049590 1.0 ug DNA
EUR 506

Lypd4 ORF Vector (Rat) (pORF)

ORF070140 1.0 ug DNA
EUR 506

LYPD4 sgRNA CRISPR Lentivector set (Human)

K1247301 3 x 1.0 ug
EUR 339

Lypd4 sgRNA CRISPR Lentivector set (Mouse)

K4176101 3 x 1.0 ug
EUR 339

Lypd4 sgRNA CRISPR Lentivector set (Rat)

K6588201 3 x 1.0 ug
EUR 339

LYPD4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1247302 1.0 ug DNA
EUR 154

LYPD4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1247303 1.0 ug DNA
EUR 154

LYPD4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1247304 1.0 ug DNA
EUR 154

Lypd4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4176102 1.0 ug DNA
EUR 154

Lypd4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4176103 1.0 ug DNA
EUR 154

Lypd4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4176104 1.0 ug DNA
EUR 154

Lypd4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6588202 1.0 ug DNA
EUR 154

Lypd4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6588203 1.0 ug DNA
EUR 154

Lypd4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6588204 1.0 ug DNA
EUR 154

LYPD4 Protein Vector (Rat) (pPB-C-His)

PV280558 500 ng
EUR 603

LYPD4 Protein Vector (Rat) (pPB-N-His)

PV280559 500 ng
EUR 603

LYPD4 Protein Vector (Rat) (pPM-C-HA)

PV280560 500 ng
EUR 603

LYPD4 Protein Vector (Rat) (pPM-C-His)

PV280561 500 ng
EUR 603

LYPD4 Protein Vector (Human) (pPB-C-His)

PV024625 500 ng
EUR 329

LYPD4 Protein Vector (Human) (pPB-N-His)

PV024626 500 ng
EUR 329

LYPD4 Protein Vector (Human) (pPM-C-HA)

PV024627 500 ng
EUR 329

LYPD4 Protein Vector (Human) (pPM-C-His)

PV024628 500 ng
EUR 329

LYPD4 Protein Vector (Mouse) (pPB-C-His)

PV198358 500 ng
EUR 603

LYPD4 Protein Vector (Mouse) (pPB-N-His)

PV198359 500 ng
EUR 603

LYPD4 Protein Vector (Mouse) (pPM-C-HA)

PV198360 500 ng
EUR 603

LYPD4 Protein Vector (Mouse) (pPM-C-His)

PV198361 500 ng
EUR 603

Lypd4 3'UTR GFP Stable Cell Line

TU162741 1.0 ml Ask for price

Lypd4 3'UTR Luciferase Stable Cell Line

TU212711 1.0 ml Ask for price

LYPD4 3'UTR Luciferase Stable Cell Line

TU012792 1.0 ml
EUR 1394

Lypd4 3'UTR Luciferase Stable Cell Line

TU112741 1.0 ml Ask for price

LYPD4 3'UTR GFP Stable Cell Line

TU062792 1.0 ml
EUR 1394

Lypd4 3'UTR GFP Stable Cell Line

TU262711 1.0 ml Ask for price

Ly6/PLAUR Domain-Containing Protein 4 (LYPD4) Antibody

abx036787-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly6/PLAUR Domain-Containing Protein 4 (LYPD4) Antibody

20-abx307928
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LYPD4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV647365 1.0 ug DNA
EUR 514

LYPD4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV647369 1.0 ug DNA
EUR 514

LYPD4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV647370 1.0 ug DNA
EUR 514

Goat Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E06L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E06L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E06L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E02L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E02L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E02L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E01L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E01L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E01L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E03L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E03L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E03L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E04L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E04L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E04L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E08L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E08L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E08L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E07L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E07L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E07L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain- containing protein 4, Lypd4 ELISA KIT

ELI-16390m 96 Tests
EUR 865

Monkey Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E09L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E09L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E09L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Ly6/PLAUR domain- containing protein 4, LYPD4 ELISA KIT

ELI-37403b 96 Tests
EUR 928

Human Ly6/PLAUR domain- containing protein 4, LYPD4 ELISA KIT

ELI-39803h 96 Tests
EUR 824

LYPD4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1247305 3 x 1.0 ug
EUR 376

Lypd4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4176105 3 x 1.0 ug
EUR 376

Lypd4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6588205 3 x 1.0 ug
EUR 376

Guinea pig Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E05L0117-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E05L0117-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ly6/PLAUR domain containing protein 4(LYPD4) ELISA kit

E05L0117-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 4(LYPD4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.