LYPD1

LYPD1 siRNA

20-abx903084
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYPD1 siRNA

20-abx923172
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYPD1 siRNA

20-abx923173
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYPD1 Antibody

39909-100ul 100ul
EUR 390

LYPD1 Rabbit pAb

A12874-100ul 100 ul
EUR 308

LYPD1 Rabbit pAb

A12874-200ul 200 ul
EUR 459

LYPD1 Rabbit pAb

A12874-20ul 20 ul
EUR 183

LYPD1 Rabbit pAb

A12874-50ul 50 ul
EUR 223

LYPD1 Polyclonal Antibody

27827-100ul 100ul
EUR 252

LYPD1 Polyclonal Antibody

27827-50ul 50ul
EUR 187

LYPD1 cloning plasmid

CSB-CL843142HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atgtgggtcctaggcatcgcggcaactttttgcggattgttcttgcttccaggctttgcgctgcaaatccagtgctaccagtgtgaagaattccagctgaacaacgactgctcctcccccgagttcattgtgaattgcacggtgaacgttcaagacatgtgtcagaaagaagtgat
  • Show more
Description: A cloning plasmid for the LYPD1 gene.

Anti-LYPD1 antibody

STJ114740 100 µl
EUR 277

LYPD1 Polyclonal Conjugated Antibody

C27827 100ul
EUR 397

Mouse LYPD1 shRNA Plasmid

20-abx977809
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat LYPD1 shRNA Plasmid

20-abx990105
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LYPD1 shRNA Plasmid

20-abx964510
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LYPD1 Recombinant Protein (Human)

RP018463 100 ug Ask for price

LYPD1 Recombinant Protein (Rat)

RP210407 100 ug Ask for price

LYPD1 Recombinant Protein (Mouse)

RP148757 100 ug Ask for price

Polyclonal LYPD1 Antibody (C-term)

APR06188G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYPD1 (C-term). This antibody is tested and proven to work in the following applications:

LYPD1 ORF Vector (Human) (pORF)

ORF006155 1.0 ug DNA
EUR 95

Lypd1 ORF Vector (Mouse) (pORF)

ORF049587 1.0 ug DNA
EUR 506

Lypd1 ORF Vector (Rat) (pORF)

ORF070137 1.0 ug DNA
EUR 506

LYPD1 ELISA Kit (Human) (OKCA00715)

OKCA00715 96 Wells
EUR 833
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

LYPD1 sgRNA CRISPR Lentivector set (Human)

K1247001 3 x 1.0 ug
EUR 339

Lypd1 sgRNA CRISPR Lentivector set (Mouse)

K3690001 3 x 1.0 ug
EUR 339

Lypd1 sgRNA CRISPR Lentivector set (Rat)

K7324101 3 x 1.0 ug
EUR 339

LYPD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1247002 1.0 ug DNA
EUR 154

LYPD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1247003 1.0 ug DNA
EUR 154

LYPD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1247004 1.0 ug DNA
EUR 154

Lypd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3690002 1.0 ug DNA
EUR 154

Lypd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3690003 1.0 ug DNA
EUR 154

Lypd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3690004 1.0 ug DNA
EUR 154

Lypd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7324102 1.0 ug DNA
EUR 154

Lypd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7324103 1.0 ug DNA
EUR 154

Lypd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7324104 1.0 ug DNA
EUR 154

LYPD1 Protein Vector (Rat) (pPB-C-His)

PV280546 500 ng
EUR 603

LYPD1 Protein Vector (Rat) (pPB-N-His)

PV280547 500 ng
EUR 603

LYPD1 Protein Vector (Rat) (pPM-C-HA)

PV280548 500 ng
EUR 603

LYPD1 Protein Vector (Rat) (pPM-C-His)

PV280549 500 ng
EUR 603

LYPD1 Protein Vector (Human) (pPB-C-His)

PV024617 500 ng
EUR 329

LYPD1 Protein Vector (Human) (pPB-N-His)

PV024618 500 ng
EUR 329

LYPD1 Protein Vector (Human) (pPM-C-HA)

PV024619 500 ng
EUR 329

LYPD1 Protein Vector (Human) (pPM-C-His)

PV024620 500 ng
EUR 329

LYPD1 Protein Vector (Mouse) (pPB-C-His)

PV198346 500 ng
EUR 603

LYPD1 Protein Vector (Mouse) (pPB-N-His)

PV198347 500 ng
EUR 603

LYPD1 Protein Vector (Mouse) (pPM-C-HA)

PV198348 500 ng
EUR 603

LYPD1 Protein Vector (Mouse) (pPM-C-His)

PV198349 500 ng
EUR 603

Lypd1 3'UTR GFP Stable Cell Line

TU162738 1.0 ml Ask for price

Lypd1 3'UTR Luciferase Stable Cell Line

TU212708 1.0 ml Ask for price

LYPD1 3'UTR Luciferase Stable Cell Line

TU012789 1.0 ml
EUR 1521

Lypd1 3'UTR Luciferase Stable Cell Line

TU112738 1.0 ml Ask for price

LYPD1 3'UTR GFP Stable Cell Line

TU062789 1.0 ml
EUR 1521

Lypd1 3'UTR GFP Stable Cell Line

TU262708 1.0 ml Ask for price

Ly6/PLAUR Domain-Containing Protein 1 (LYPD1) Antibody

abx037729-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

LYPD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV686113 1.0 ug DNA
EUR 514

LYPD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV686117 1.0 ug DNA
EUR 514

LYPD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV686118 1.0 ug DNA
EUR 514

Goat Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E06L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E06L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E06L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E02L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E02L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E02L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E01L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E01L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E01L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E03L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E03L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E03L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E04L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E04L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E04L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E08L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E08L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E08L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E07L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E07L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E07L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain- containing protein 1, LYPD1 ELISA KIT

ELI-22789h 96 Tests
EUR 824

Monkey Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E09L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E09L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E09L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain- containing protein 1, Lypd1 ELISA KIT

ELI-45839m 96 Tests
EUR 865

LYPD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1247005 3 x 1.0 ug
EUR 376

Lypd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3690005 3 x 1.0 ug
EUR 376

Human Ly6/PLAUR domain-containing protein 1(LYPD1) ELISA kit

CSB-EL013261HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ly6/PLAUR domain-containing protein 1 (LYPD1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ly6/PLAUR domain-containing protein 1(LYPD1) ELISA kit

1-CSB-EL013261HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ly6/PLAUR domain-containing protein 1(LYPD1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Lypd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7324105 3 x 1.0 ug
EUR 376

Guinea pig Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E05L0114-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E05L0114-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ly6/PLAUR domain containing protein 1(LYPD1) ELISA kit

E05L0114-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 1(LYPD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

LYPD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1247006 1.0 ug DNA
EUR 167

LYPD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1247007 1.0 ug DNA
EUR 167

LYPD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1247008 1.0 ug DNA
EUR 167