LSAMP antibody

70R-18316 50 ul
EUR 435
Description: Rabbit polyclonal LSAMP antibody

LSAMP Antibody

42962-100ul 100ul
EUR 252

LSAMP antibody

70R-6118 50 ug
EUR 467
Description: Rabbit polyclonal LSAMP antibody raised against the N terminal of LSAMP

LSAMP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LSAMP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12985 50 ug
EUR 363
Description: Mouse polyclonal to LSAMP

LSAMP Rabbit pAb

A14248-100ul 100 ul
EUR 308

LSAMP Rabbit pAb

A14248-200ul 200 ul
EUR 459

LSAMP Rabbit pAb

A14248-20ul 20 ul
EUR 183

LSAMP Rabbit pAb

A14248-50ul 50 ul
EUR 223

LSAMP Blocking Peptide

33R-6605 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LSAMP antibody, catalog no. 70R-6118

LSAMP Conjugated Antibody

C42962 100ul
EUR 397

LSAMP cloning plasmid

CSB-CL013197HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atggtcaggagagttcagccggatcggaaacagttgccactggtcctactgagattgctctgccttcttcccacaggactgcctgttcgcagcgtggattttaaccgaggcacggacaacatcaccgtgaggcagggggacacagccatcctcaggtgcgttgtagaagacaaga
  • Show more
Description: A cloning plasmid for the LSAMP gene.

LSAMP Polyclonal Antibody

A69583 100 ?g
EUR 628.55
Description: kits suitable for this type of research

anti- LSAMP antibody

FNab04868 100µg
EUR 548.75
  • Immunogen: limbic system-associated membrane protein
  • Uniprot ID: Q13449
  • Gene ID: 4045
  • Research Area: Neuroscience, Immunology, Developmental biology
Description: Antibody raised against LSAMP

Anti-LSAMP antibody

PAab04868 100 ug
EUR 386

Anti-LSAMP antibody

STJ116461 100 µl
EUR 277
Description: This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.


EF010736 96 Tests
EUR 689

Mouse Lsamp ELISA KIT

ELI-42189m 96 Tests
EUR 865


ELI-45828h 96 Tests
EUR 824

Rat LSAMP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LSAMP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LSAMP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LSAMP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LSAMP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LSAMP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LSAMP Recombinant Protein (Human)

RP018346 100 ug Ask for price

LSAMP Recombinant Protein (Mouse)

RP148469 100 ug Ask for price

LSAMP Recombinant Protein (Rat)

RP210176 100 ug Ask for price

LSAMP Polyclonal Antibody, HRP Conjugated

A69584 100 ?g
EUR 628.55
Description: fast delivery possible

LSAMP Polyclonal Antibody, FITC Conjugated

A69585 100 ?g
EUR 628.55
Description: reagents widely cited

LSAMP Polyclonal Antibody, Biotin Conjugated

A69586 100 ?g
EUR 628.55
Description: Ask the seller for details

Lsamp ORF Vector (Rat) (pORF)

ORF070060 1.0 ug DNA
EUR 506

LSAMP ORF Vector (Human) (pORF)

ORF006116 1.0 ug DNA
EUR 95

Lsamp ORF Vector (Mouse) (pORF)

ORF049491 1.0 ug DNA
EUR 506

Lsamp sgRNA CRISPR Lentivector set (Mouse)

K4930701 3 x 1.0 ug
EUR 339

Lsamp sgRNA CRISPR Lentivector set (Rat)

K6814801 3 x 1.0 ug
EUR 339

LSAMP sgRNA CRISPR Lentivector set (Human)

K1240501 3 x 1.0 ug
EUR 339

LSAMP-AS1 ORF Vector (Human) (pORF)

ORF023154 1.0 ug DNA Ask for price

LSAMP-AS2 ORF Vector (Human) (pORF)

ORF023155 1.0 ug DNA Ask for price

LSAMP-AS3 ORF Vector (Human) (pORF)

ORF023156 1.0 ug DNA Ask for price

LSAMP-AS4 ORF Vector (Human) (pORF)

ORF023157 1.0 ug DNA Ask for price

Limbic System-Associated Membrane Protein (LSAMP) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody

abx146203-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody

abx234868-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Lsamp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4930702 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4930703 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4930704 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6814802 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6814803 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Rat) (Target 3)

K6814804 1.0 ug DNA
EUR 154

LSAMP sgRNA CRISPR Lentivector (Human) (Target 1)

K1240502 1.0 ug DNA
EUR 154

LSAMP sgRNA CRISPR Lentivector (Human) (Target 2)

K1240503 1.0 ug DNA
EUR 154

LSAMP sgRNA CRISPR Lentivector (Human) (Target 3)

K1240504 1.0 ug DNA
EUR 154

LSAMP Protein Vector (Human) (pPB-C-His)

PV024461 500 ng
EUR 329

LSAMP Protein Vector (Human) (pPB-N-His)

PV024462 500 ng
EUR 329

LSAMP Protein Vector (Human) (pPM-C-HA)

PV024463 500 ng
EUR 329

LSAMP Protein Vector (Human) (pPM-C-His)

PV024464 500 ng
EUR 329

LSAMP Protein Vector (Rat) (pPB-C-His)

PV280238 500 ng
EUR 603

LSAMP Protein Vector (Rat) (pPB-N-His)

PV280239 500 ng
EUR 603

LSAMP Protein Vector (Rat) (pPM-C-HA)

PV280240 500 ng
EUR 603

LSAMP Protein Vector (Rat) (pPM-C-His)

PV280241 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPB-C-His)

PV197962 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPB-N-His)

PV197963 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPM-C-HA)

PV197964 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPM-C-His)

PV197965 500 ng
EUR 603

Lsamp 3'UTR Luciferase Stable Cell Line

TU112670 1.0 ml Ask for price

Lsamp 3'UTR GFP Stable Cell Line

TU162670 1.0 ml Ask for price

Lsamp 3'UTR Luciferase Stable Cell Line

TU212627 1.0 ml Ask for price

Lsamp 3'UTR GFP Stable Cell Line

TU262627 1.0 ml Ask for price

LSAMP 3'UTR GFP Stable Cell Line

TU062722 1.0 ml
EUR 1394

LSAMP 3'UTR Luciferase Stable Cell Line

TU012722 1.0 ml
EUR 1394

Limbic System-Associated Membrane Protein (LSAMP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LSAMP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV684901 1.0 ug DNA
EUR 682

LSAMP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV684905 1.0 ug DNA
EUR 682

LSAMP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV684906 1.0 ug DNA
EUR 682

Lsamp ELISA Kit| Rat Limbic system-associated membrane protein

EF018912 96 Tests
EUR 689

Lsamp ELISA Kit| Mouse Limbic system-associated membrane protei

EF015391 96 Tests
EUR 689

Rat Limbic System-Associated Membrane Protein (LSAMP) ELISA Kit

abx391554-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Limbic System-Associated Membrane Protein (LSAMP) ELISA Kit

abx388329-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Limbic System-Associated Membrane Protein (LSAMP) ELISA Kit

abx389756-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

LSAMP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV732287 1.0 ug DNA Ask for price

LSAMP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV732291 1.0 ug DNA Ask for price

LSAMP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV732292 1.0 ug DNA Ask for price

LSAMP-AS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV732293 1.0 ug DNA Ask for price

LSAMP-AS2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV732297 1.0 ug DNA Ask for price

LSAMP-AS2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV732298 1.0 ug DNA Ask for price

LSAMP-AS4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV732299 1.0 ug DNA Ask for price

LSAMP-AS4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV732303 1.0 ug DNA Ask for price