KIF5B

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Hu-96T 96T
EUR 673
  • Should the Human Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Mu-48T 48T
EUR 527
  • Should the Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Mu-96T 96T
EUR 688
  • Should the Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Ra-48T 48T
EUR 549
  • Should the Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Ra-96T 96T
EUR 718
  • Should the Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Hu-48Tests 48 Tests
EUR 544

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Hu-96Tests 96 Tests
EUR 756

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Mu-48Tests 48 Tests
EUR 557

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Mu-96Tests 96 Tests
EUR 774

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Ra-48Tests 48 Tests
EUR 583

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Ra-96Tests 96 Tests
EUR 811

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Hu-48Tests 48 Tests
EUR 521

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Hu-96Tests 96 Tests
EUR 723

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Mu-48Tests 48 Tests
EUR 533

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Mu-96Tests 96 Tests
EUR 740

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Ra-48Tests 48 Tests
EUR 557

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Ra-96Tests 96 Tests
EUR 775

Kif5b/ Rat Kif5b ELISA Kit

ELI-37195r 96 Tests
EUR 886

KIF5B antibody

70R-5541 50 ug
EUR 467
Description: Rabbit polyclonal KIF5B antibody raised against the C terminal of KIF5B

KIF5B antibody

70R-5599 50 ug
EUR 467
Description: Rabbit polyclonal KIF5B antibody raised against the N terminal of KIF5B

KIF5B Antibody

1-CSB-PA012342LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

KIF5B siRNA

20-abx902849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF5B siRNA

20-abx921641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF5B siRNA

20-abx921642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF5B Antibody

AF7947 200ul
EUR 376
Description: KIF5B Antibody detects endogenous levels of KIF5B.

KIF5B Polyclonal Antibody

28899-100ul 100ul
EUR 252

KIF5B Polyclonal Antibody

28899-50ul 50ul
EUR 187

KIF5B Rabbit pAb

A15284-100ul 100 ul
EUR 308

KIF5B Rabbit pAb

A15284-200ul 200 ul
EUR 459

KIF5B Rabbit pAb

A15284-20ul 20 ul
EUR 183

KIF5B Rabbit pAb

A15284-50ul 50 ul
EUR 223

KIF5B Blocking Peptide

33R-1396 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF5B antibody, catalog no. 70R-5541

KIF5B Blocking Peptide

33R-1753 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF5B antibody, catalog no. 70R-5599

KIF5B Blocking Peptide

AF7947-BP 1mg
EUR 195

KIF5B cloning plasmid

CSB-CL012342HU-10ug 10ug
EUR 919
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2892
  • Sequence: atggcggacctggccgagtgcaacatcaaagtgatgtgtcgcttcagacctctcaacgagtctgaagtgaaccgcggcgacaagtacatcgccaagtttcagggagaagacacggtcgtgatcgcgtccaagccttatgcatttgatcgggtgttccagtcaagcacatctcaag
  • Show more
Description: A cloning plasmid for the KIF5B gene.

anti- KIF5B antibody

FNab04567 100µg
EUR 505.25
  • Immunogen: kinesin family member 5B
  • Uniprot ID: P33176
  • Gene ID: 3799
  • Research Area: Neuroscience
Description: Antibody raised against KIF5B

Anti-KIF5B antibody

PAab04567 100 ug
EUR 355

pCR4-TOPO-KIF5B

PVT14703 2 ug
EUR 495

Anti-KIF5B antibody

STJ117479 100 µl
EUR 277

KIF5B (Phospho-Ser154) Antibody

13288-100ul 100ul
EUR 252

KIF5B (Phospho-Ser154) Antibody

13288-50ul 50ul
EUR 187

KIF5B ELISA KIT|Human

EF010524 96 Tests
EUR 689

Phospho-KIF5B (Ser154) Antibody

AF7447 200ul
EUR 376
Description: Phospho-KIF5B (Ser154) Antibody detects endogenous levels of KIF5B only when phosphorylated at Ser154.

Rat KIF5B shRNA Plasmid

20-abx987473
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIF5B Polyclonal Conjugated Antibody

C28899 100ul
EUR 397

KIF5B Antibody, HRP conjugated

1-CSB-PA012342LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KIF5B Antibody, FITC conjugated

1-CSB-PA012342LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KIF5B Antibody, Biotin conjugated

1-CSB-PA012342LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human KIF5B shRNA Plasmid

20-abx952570
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse KIF5B shRNA Plasmid

20-abx971190
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-KIF5B (Ser154) Blocking Peptide

AF7447-BP 1mg
EUR 195

KIF5B (Phospho-Ser154) Conjugated Antibody

C13288 100ul
EUR 397

Kif5b ORF Vector (Rat) (pORF)

ORF069059 1.0 ug DNA
EUR 506

KIF5B ORF Vector (Human) (pORF)

ORF013470 1.0 ug DNA
EUR 354

Kif5b ORF Vector (Mouse) (pORF)

ORF048585 1.0 ug DNA
EUR 506

KIF5B ELISA Kit (Rat) (OKCD08800)

OKCD08800 96 Wells
EUR 1053
Description: Description of target: mouse homolog is the heavy chain of kinesin; essential for mitochondrial and lysosomal dispersion.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

KIF5B ELISA Kit (Rat) (OKDD00860)

OKDD00860 96 Wells
EUR 1040
Description: Description of target: Mouse homolog is the heavy chain of kinesin, essential for mitochondrial and lysosomal dispersion [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.059ng/mL

Kinesin Family, Member 5B (KIF5B) Antibody

20-abx130104
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinesin Family, Member 5B (KIF5B) Antibody

20-abx173265
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kinesin Family, Member 5B (KIF5B) Antibody

20-abx338851
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin-1 Heavy Chain (KIF5B) Antibody

abx234567-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Kif5b sgRNA CRISPR Lentivector set (Rat)

K6962801 3 x 1.0 ug
EUR 339

Kif5b sgRNA CRISPR Lentivector set (Mouse)

K3841701 3 x 1.0 ug
EUR 339

KIF5B sgRNA CRISPR Lentivector set (Human)

K1146801 3 x 1.0 ug
EUR 339

Recombinant Kinesin Family, Member 5B (KIF5B)

4-RPF507Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q2PQA9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Kinesin Family, Member 5B expressed in: E.coli

Rat Kinesin Family, Member 5B (KIF5B) Protein

20-abx167614
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinesin Family, Member 5B (KIF5B) Antibody (HRP)

20-abx336249
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin Family, Member 5B (KIF5B) Antibody (FITC)

20-abx336250
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin Family, Member 5B (KIF5B) Antibody (Biotin)

20-abx336251
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kif5b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6962802 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6962803 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6962804 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3841702 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3841703 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3841704 1.0 ug DNA
EUR 154

KIF5B sgRNA CRISPR Lentivector (Human) (Target 1)

K1146802 1.0 ug DNA
EUR 154

KIF5B sgRNA CRISPR Lentivector (Human) (Target 2)

K1146803 1.0 ug DNA
EUR 154

KIF5B sgRNA CRISPR Lentivector (Human) (Target 3)

K1146804 1.0 ug DNA
EUR 154

KIF5B Protein Vector (Rat) (pPB-C-His)

PV276234 500 ng
EUR 1166

KIF5B Protein Vector (Rat) (pPB-N-His)

PV276235 500 ng
EUR 1166

KIF5B Protein Vector (Rat) (pPM-C-HA)

PV276236 500 ng
EUR 1166

KIF5B Protein Vector (Rat) (pPM-C-His)

PV276237 500 ng
EUR 1166

KIF5B Protein Vector (Mouse) (pPB-C-His)

PV194338 500 ng
EUR 1065

KIF5B Protein Vector (Mouse) (pPB-N-His)

PV194339 500 ng
EUR 1065

KIF5B Protein Vector (Mouse) (pPM-C-HA)

PV194340 500 ng
EUR 1065

KIF5B Protein Vector (Mouse) (pPM-C-His)

PV194341 500 ng
EUR 1065

KIF5B Protein Vector (Human) (pPB-C-His)

PV053877 500 ng
EUR 481

KIF5B Protein Vector (Human) (pPB-N-His)

PV053878 500 ng
EUR 481

KIF5B Protein Vector (Human) (pPM-C-HA)

PV053879 500 ng
EUR 481

KIF5B Protein Vector (Human) (pPM-C-His)

PV053880 500 ng
EUR 481

Kif5b 3'UTR Luciferase Stable Cell Line

TU110573 1.0 ml Ask for price

Kif5b 3'UTR GFP Stable Cell Line

TU160573 1.0 ml Ask for price

Kif5b 3'UTR Luciferase Stable Cell Line

TU206706 1.0 ml Ask for price

Kif5b 3'UTR GFP Stable Cell Line

TU256706 1.0 ml Ask for price

KIF5B 3'UTR GFP Stable Cell Line

TU061761 1.0 ml
EUR 1521