
Mobile: 0032476375875

Lab Reagentia

Recente artiekels

Bezoek of bel ons



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KDELR2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KDELR2. Recognizes KDELR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000


YF-PA17362 100 ug
EUR 403
Description: Rabbit polyclonal to KDELR2

KDELR2 cloning plasmid

CSB-CL012130HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgta
  • Show more
Description: A cloning plasmid for the KDELR2 gene.

KDELR2 cloning plasmid

CSB-CL012130HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgta
  • Show more
Description: A cloning plasmid for the KDELR2 gene.

KDELR2 cloning plasmid

CSB-CL012130HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 561
  • Sequence: atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgta
  • Show more
Description: A cloning plasmid for the KDELR2 gene.

KDELR2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Mouse KDELR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat KDELR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KDELR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KDELR2 Recombinant Protein (Human)

RP016726 100 ug Ask for price

KDELR2 Recombinant Protein (Human)

RP016729 100 ug Ask for price

KDELR2 Recombinant Protein (Human)

RP016732 100 ug Ask for price

pENTR223-KDELR2-T11 vector

PVT11879 2 ug
EUR 304

KDELR2 Recombinant Protein (Rat)

RP207026 100 ug Ask for price

KDELR2 Recombinant Protein (Mouse)

RP145499 100 ug Ask for price

Polyclonal KDELR2 Antibody (aa100-150)

APR16989G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDELR2 (aa100-150). This antibody is tested and proven to work in the following applications:

Polyclonal KDELR2 Antibody (aa81-130)

APR16990G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDELR2 (aa81-130). This antibody is tested and proven to work in the following applications:

Polyclonal KDELR2 Antibody - middle region

APR16991G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDELR2 - middle region. This antibody is tested and proven to work in the following applications:

KDELR2 ORF Vector (Human) (pORF)

ORF005576 1.0 ug DNA
EUR 95

KDELR2 ORF Vector (Human) (pORF)

ORF005577 1.0 ug DNA
EUR 95

KDELR2 ORF Vector (Human) (pORF)

ORF005578 1.0 ug DNA
EUR 95

Kdelr2 ORF Vector (Rat) (pORF)

ORF069010 1.0 ug DNA
EUR 506

Kdelr2 ORF Vector (Mouse) (pORF)

ORF048501 1.0 ug DNA
EUR 506

KDELR2 sgRNA CRISPR Lentivector set (Human)

K1128901 3 x 1.0 ug
EUR 339

Kdelr2 sgRNA CRISPR Lentivector set (Mouse)

K3516701 3 x 1.0 ug
EUR 339

Kdelr2 sgRNA CRISPR Lentivector set (Rat)

K6672801 3 x 1.0 ug
EUR 339

KDELR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1128902 1.0 ug DNA
EUR 154

KDELR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1128903 1.0 ug DNA
EUR 154

KDELR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1128904 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3516702 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3516703 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3516704 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6672802 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6672803 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6672804 1.0 ug DNA
EUR 154

KDELR2 Protein Vector (Human) (pPB-C-His)

PV022301 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-N-His)

PV022302 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-HA)

PV022303 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-His)

PV022304 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-C-His)

PV022305 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-N-His)

PV022306 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-HA)

PV022307 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-His)

PV022308 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-C-His)

PV022309 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-N-His)

PV022310 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-HA)

PV022311 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-His)

PV022312 500 ng
EUR 329

KDELR2 Protein Vector (Rat) (pPB-C-His)

PV276038 500 ng
EUR 603

KDELR2 Protein Vector (Rat) (pPB-N-His)

PV276039 500 ng
EUR 603

KDELR2 Protein Vector (Rat) (pPM-C-HA)

PV276040 500 ng
EUR 603

KDELR2 Protein Vector (Rat) (pPM-C-His)

PV276041 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPB-C-His)

PV194002 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPB-N-His)

PV194003 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPM-C-HA)

PV194004 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPM-C-His)

PV194005 500 ng
EUR 603

Kdelr2 3'UTR Luciferase Stable Cell Line

TU206651 1.0 ml Ask for price

Kdelr2 3'UTR GFP Stable Cell Line

TU160507 1.0 ml Ask for price

KDELR2 3'UTR Luciferase Stable Cell Line

TU011582 1.0 ml
EUR 1521

Kdelr2 3'UTR Luciferase Stable Cell Line

TU110507 1.0 ml Ask for price

KDELR2 3'UTR GFP Stable Cell Line

TU061582 1.0 ml
EUR 1521

Kdelr2 3'UTR GFP Stable Cell Line

TU256651 1.0 ml Ask for price

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679813 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679817 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679818 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711585 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711589 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711590 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711591 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711595 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711596 1.0 ug DNA
EUR 316

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

abx028251-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

abx028251-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse ER lumen protein retaining receptor 2, Kdelr2 ELISA KIT

ELI-20492m 96 Tests
EUR 865

Chicken ER lumen protein retaining receptor 2, KDELR2 ELISA KIT

ELI-09240c 96 Tests
EUR 928

Human ER lumen protein retaining receptor 2, KDELR2 ELISA KIT

ELI-32782h 96 Tests
EUR 824

Bovine ER lumen protein retaining receptor 2, KDELR2 ELISA KIT

ELI-47279b 96 Tests
EUR 928

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1128905 3 x 1.0 ug
EUR 376

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3516705 3 x 1.0 ug
EUR 376

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6672805 3 x 1.0 ug
EUR 376

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1128906 1.0 ug DNA
EUR 167

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1128907 1.0 ug DNA
EUR 167

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1128908 1.0 ug DNA
EUR 167

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3516706 1.0 ug DNA
EUR 167

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3516707 1.0 ug DNA
EUR 167

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3516708 1.0 ug DNA
EUR 167

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV679814 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV679815 1.0 ug DNA
EUR 572

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV679816 1.0 ug DNA
EUR 572

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV711586 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV711587 1.0 ug DNA
EUR 374