HYOU1

Human Hypoxia Up Regulated 1 (HYOU1) ELISA Kit

DLR-HYOU1-Hu-96T 96T
EUR 673
  • Should the Human Hypoxia Up Regulated 1 (HYOU1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hypoxia Up Regulated 1 (HYOU1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hypoxia Up Regulated 1 (HYOU1) ELISA Kit

RDR-HYOU1-Hu-48Tests 48 Tests
EUR 544

Human Hypoxia Up Regulated 1 (HYOU1) ELISA Kit

RDR-HYOU1-Hu-96Tests 96 Tests
EUR 756

Human Hypoxia Up Regulated 1 (HYOU1) ELISA Kit

RD-HYOU1-Hu-48Tests 48 Tests
EUR 521

Human Hypoxia Up Regulated 1 (HYOU1) ELISA Kit

RD-HYOU1-Hu-96Tests 96 Tests
EUR 723

Hyou1/ Rat Hyou1 ELISA Kit

ELI-31524r 96 Tests
EUR 886

HYOU1 antibody

39053-100ul 100ul
EUR 252

HYOU1 Antibody

1-CSB-PA896895ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HYOU1. Recognizes HYOU1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HYOU1 Antibody

DF8329 200ul
EUR 304
Description: HYOU1 Antibody detects endogenous levels of total HYOU1.

HYOU1 antibody

70R-6400 50 ug
EUR 467
Description: Rabbit polyclonal HYOU1 antibody raised against the middle region of HYOU1

HYOU1 siRNA

20-abx902593
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HYOU1 siRNA

20-abx920086
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HYOU1 siRNA

20-abx920087
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HYOU1 Antibody

ABD8329 100 ug
EUR 438

anti-HYOU1

YF-PA17024 50 ug
EUR 363
Description: Mouse polyclonal to HYOU1

anti-HYOU1

YF-PA25605 50 ul
EUR 334
Description: Mouse polyclonal to HYOU1

HYOU1 Rabbit pAb

A12313-100ul 100 ul
EUR 308

HYOU1 Rabbit pAb

A12313-200ul 200 ul
EUR 459

HYOU1 Rabbit pAb

A12313-20ul 20 ul
EUR 183

HYOU1 Rabbit pAb

A12313-50ul 50 ul
EUR 223

HYOU1 Blocking Peptide

33R-2141 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HYOU1 antibody, catalog no. 70R-6400

HYOU1 cloning plasmid

CSB-CL896895HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atggcagacaaagttaggaggcagaggccgaggaggcgagtctgttgggccttggtggctgtgctcttggcagacctgttggcactgagtgatacactggcagtgatgtctgtggacctgggcagtgagtccatgaaggtggccattgtcaaacctggagtgcccatggaaattgt
  • Show more
Description: A cloning plasmid for the HYOU1 gene.

HYOU1 Blocking Peptide

DF8329-BP 1mg
EUR 195

HYOU1 Conjugated Antibody

C39053 100ul
EUR 397

HYOU1 Rabbit pAb

A6625-100ul 100 ul
EUR 308

HYOU1 Rabbit pAb

A6625-200ul 200 ul
EUR 459

HYOU1 Rabbit pAb

A6625-20ul 20 ul
EUR 183

HYOU1 Rabbit pAb

A6625-50ul 50 ul
EUR 223

anti- HYOU1 antibody

FNab10247 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: Hypoxia up-regulated protein 1
  • Uniprot ID: Q9Y4L1
  • Gene ID: 10525
  • Research Area: Cancer, Cardiovascular
Description: Antibody raised against HYOU1

Anti-HYOU1 antibody

STJ28708 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants.

Anti-HYOU1 antibody

STJ114199 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants.

Anti-HYOU1 Antibody

STJ501377 100 µg
EUR 476

Anti-HYOU1 (6F7)

YF-MA11294 100 ug
EUR 363
Description: Mouse monoclonal to HYOU1

Human HYOU1 ELISA Kit

EHH0139 96Tests
EUR 521

Goat HYOU1 ELISA Kit

EGTH0139 96Tests
EUR 521

Bovine HYOU1 ELISA Kit

EBH0139 96Tests
EUR 521

Canine HYOU1 ELISA Kit

ECH0139 96Tests
EUR 521

Chicken HYOU1 ELISA Kit

ECKH0139 96Tests
EUR 521

Anserini HYOU1 ELISA Kit

EAH0139 96Tests
EUR 521

HYOU1 ELISA KIT|Human

EF006921 96 Tests
EUR 689

Rat HYOU1 shRNA Plasmid

20-abx987852
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal HYOU1 Antibody (Center)

APR07905G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HYOU1 (Center). This antibody is tested and proven to work in the following applications:

Human HYOU1 shRNA Plasmid

20-abx957152
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HYOU1 shRNA Plasmid

20-abx969419
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat HYOU1 ELISA Kit

ERH0139 96Tests
EUR 521

Sheep HYOU1 ELISA Kit

ESH0139 96Tests
EUR 521

Rabbit HYOU1 ELISA Kit

ERTH0139 96Tests
EUR 521

Mouse HYOU1 ELISA Kit

EMH0139 96Tests
EUR 521

Monkey HYOU1 ELISA Kit

EMKH0139 96Tests
EUR 521

Porcine HYOU1 ELISA Kit

EPH0139 96Tests
EUR 521

Anti-HYOU1 Antibody (Biotin)

STJ501378 100 µg
EUR 586

Anti-HYOU1 Antibody (FITC)

STJ501379 100 µg
EUR 586

Guinea Pig HYOU1 ELISA Kit

EGH0139 96Tests
EUR 521

Hyou1 ORF Vector (Rat) (pORF)

ORF068462 1.0 ug DNA
EUR 506

Hyou1 ORF Vector (Rat) (pORF)

ORF068463 1.0 ug DNA
EUR 506

HYOU1 ORF Vector (Human) (pORF)

ORF005162 1.0 ug DNA
EUR 95

Hyou1 ORF Vector (Mouse) (pORF)

ORF047604 1.0 ug DNA
EUR 506

HYOU1 ELISA Kit (Human) (OKCD01680)

OKCD01680 96 Wells
EUR 831
Description: Description of target: Has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. May play a role as a molecular chaperone and participate in protein folding.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

HYOU1 ELISA Kit (Rat) (OKEI00919)

OKEI00919 96 Wells
EUR 767
Description: Description of target: Has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. May play a role as a molecular chaperone and participate in protein folding.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Hypoxia Up-Regulated 1 (HYOU1) Antibody

20-abx005079
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.