HDGF

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Hu-96T 96T
EUR 548
  • Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Mu-48T 48T
EUR 435
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Mu-96T 96T
EUR 561
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Hu-48Tests 48 Tests
EUR 418

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Hu-96Tests 96 Tests
EUR 575

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Mu-48Tests 48 Tests
EUR 429

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Mu-96Tests 96 Tests
EUR 591

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Hu-48Tests 48 Tests
EUR 436

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Hu-96Tests 96 Tests
EUR 601

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Mu-48Tests 48 Tests
EUR 447

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Mu-96Tests 96 Tests
EUR 618

Hdgf/ Rat Hdgf ELISA Kit

ELI-38905r 96 Tests
EUR 886

HDGF siRNA

20-abx902439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF siRNA

20-abx919203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF siRNA

20-abx919204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF Antibody

ABD7289 100 ug
EUR 438

HDGF protein

30R-1402 100 ug
EUR 397
Description: Purified recombinant Human HDGF protein

HDGF Antibody

32788-100ul 100ul
EUR 252

HDGF antibody

10R-1523 100 ug
EUR 512
Description: Mouse monoclonal HDGF antibody

HDGF antibody

70R-17711 50 ul
EUR 435
Description: Rabbit polyclonal HDGF antibody

HDGF Antibody

DF7289 200ul
EUR 304
Description: HDGF Antibody detects endogenous levels of total HDGF.

HDGF Antibody

1-CSB-PA01004A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA

HDGF Antibody

1-CSB-PA010249GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-HDGF

PVT14602 2 ug
EUR 495

anti-HDGF

YF-PA12275 50 ug
EUR 363
Description: Mouse polyclonal to HDGF

anti-HDGF

YF-PA23871 50 ul
EUR 334
Description: Mouse polyclonal to HDGF

Polyclonal HDGF Antibody

APR03208G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF . This antibody is tested and proven to work in the following applications:

HDGF Conjugated Antibody

C32788 100ul
EUR 397

HDGF cloning plasmid

CSB-CL010249HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctggg
  • Show more
Description: A cloning plasmid for the HDGF gene.

anti- HDGF antibody

FNab03808 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: hepatoma-derived growth factor (high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 3068
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

anti- HDGF antibody

FNab03809 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IF: 1:10-1:100
  • IHC: 1:50-1:500
  • Immunogen: hepatoma-derived growth factor(high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 81932
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

HDGF Polyclonal Antibody

ES8731-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA

HDGF Polyclonal Antibody

ES8731-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA

HDGF Polyclonal Antibody

ABP58763-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ABP58763-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ABP58763-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

Anti-HDGF Antibody

A01057 100ug/vial
EUR 334

HDGF Polyclonal Antibody

A53048 100 µg
EUR 570.55
Description: Ask the seller for details

HDGF Rabbit pAb

A5347-100ul 100 ul
EUR 308

HDGF Rabbit pAb

A5347-200ul 200 ul
EUR 459

HDGF Rabbit pAb

A5347-20ul 20 ul
EUR 183

HDGF Rabbit pAb

A5347-50ul 50 ul
EUR 223

HDGF Rabbit pAb

A13654-100ul 100 ul
EUR 308

HDGF Rabbit pAb

A13654-200ul 200 ul
EUR 459

HDGF Rabbit pAb

A13654-20ul 20 ul
EUR 183

HDGF Rabbit pAb

A13654-50ul 50 ul
EUR 223

HDGF Polyclonal Antibody

46852-100ul 100ul
EUR 252

HDGF Polyclonal Antibody

46852-50ul 50ul
EUR 187

HDGF Blocking Peptide

DF7289-BP 1mg
EUR 195

Anti-HDGF antibody

PAab03808 100 ug
EUR 412

pOTB7-HDGF Plasmid

PVTB00247S 2 ug
EUR 356

Anti-HDGF antibody

STJ98794 200 µl
EUR 197
Description: Rabbit polyclonal to HDGF.

Anti-HDGF antibody

STJ27300 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF antibody

STJ115610 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF (2D6)

YF-MA13429 100 ug
EUR 363
Description: Mouse monoclonal to HDGF

Rat HDGF shRNA Plasmid

20-abx987193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HDGF ELISA Kit

EHH0054 96Tests
EUR 521

Goat HDGF ELISA Kit

EGTH0054 96Tests
EUR 521

Bovine HDGF ELISA Kit

EBH0054 96Tests
EUR 521

Anserini HDGF ELISA Kit

EAH0054 96Tests
EUR 521