GRPEL2 siRNA
20-abx918747	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GRPEL2 antibody
70R-2426	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GRPEL2 antibody

GRPEL2 Antibody
1-CSB-PA819443ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL2. Recognizes GRPEL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-GRPEL2
YF-PA22237	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to GRPEL2

GRPEL2 Rabbit pAb
A8339-100ul	Abclonal	100 ul	EUR 308

GRPEL2 Rabbit pAb
A8339-200ul	Abclonal	200 ul	EUR 459

GRPEL2 Rabbit pAb
A8339-20ul	Abclonal	20 ul	EUR 183

GRPEL2 Rabbit pAb
A8339-50ul	Abclonal	50 ul	EUR 223

GRPEL2 Blocking Peptide
33R-3717	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRPEL2 antibody, catalog no. 70R-2426

GRPEL2 Polyclonal Antibody
31516-100ul	SAB	100ul	EUR 252

GRPEL2 Polyclonal Antibody
31516-50ul	SAB	50ul	EUR 187

GRPEL2 cloning plasmid
CSB-CL819443HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 678 Sequence: atggccgtacggtcgctgtgggcgggccggctgcgggtgcagcgcctactggcctggagtgccgcgtgggagagcaagggatggccgcttccattcagcactgccacccagagaactgctggtgaggactgccgttctgaggaccctcctgatgagcttgggccccctcttgctga Show more
Description: A cloning plasmid for the GRPEL2 gene.

Anti-GRPEL2 antibody
STJ110637	St John's Laboratory	100 µl	EUR 277

GRPEL2 Polyclonal Conjugated Antibody
C31516	SAB	100ul	EUR 397

Human GRPEL2 shRNA Plasmid
20-abx965136	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GRPEL2 shRNA Plasmid
20-abx971591	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GRPEL2 Recombinant Protein (Human)
RP014065	ABM	100 ug	Ask for price

GRPEL2 Recombinant Protein (Rat)
RP203762	ABM	100 ug	Ask for price

GRPEL2 Recombinant Protein (Mouse)
RP140111	ABM	100 ug	Ask for price

GRPEL2 ORF Vector (Human) (pORF)
ORF004689	ABM	1.0 ug DNA	EUR 95

Grpel2 ORF Vector (Rat) (pORF)
ORF067922	ABM	1.0 ug DNA	EUR 506

Grpel2 ORF Vector (Mouse) (pORF)
ORF046705	ABM	1.0 ug DNA	EUR 506

GRPEL2 sgRNA CRISPR Lentivector set (Human)
K0909801	ABM	3 x 1.0 ug	EUR 339

Grpel2 sgRNA CRISPR Lentivector set (Rat)
K6120901	ABM	3 x 1.0 ug	EUR 339

Grpel2 sgRNA CRISPR Lentivector set (Mouse)
K3371501	ABM	3 x 1.0 ug	EUR 339

GRPEL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0909802	ABM	1.0 ug DNA	EUR 154

GRPEL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0909803	ABM	1.0 ug DNA	EUR 154

GRPEL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0909804	ABM	1.0 ug DNA	EUR 154

GrpE Protein Homolog 2, Mitochondrial (GrpEL2) Antibody
20-abx141558	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody
20-abx005913	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody
abx030831-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody
abx030831-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody
20-abx321311	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Grpel2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6120902	ABM	1.0 ug DNA	EUR 154

Grpel2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6120903	ABM	1.0 ug DNA	EUR 154

Grpel2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6120904	ABM	1.0 ug DNA	EUR 154

Grpel2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3371502	ABM	1.0 ug DNA	EUR 154

Grpel2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3371503	ABM	1.0 ug DNA	EUR 154

Grpel2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3371504	ABM	1.0 ug DNA	EUR 154

GRPEL2 Protein Vector (Rat) (pPB-C-His)
PV271686	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Rat) (pPB-N-His)
PV271687	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Rat) (pPM-C-HA)
PV271688	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Rat) (pPM-C-His)
PV271689	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Human) (pPB-C-His)
PV018753	ABM	500 ng	EUR 329

GRPEL2 Protein Vector (Human) (pPB-N-His)
PV018754	ABM	500 ng	EUR 329

GRPEL2 Protein Vector (Human) (pPM-C-HA)
PV018755	ABM	500 ng	EUR 329

GRPEL2 Protein Vector (Human) (pPM-C-His)
PV018756	ABM	500 ng	EUR 329

GRPEL2 Protein Vector (Mouse) (pPB-C-His)
PV186818	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Mouse) (pPB-N-His)
PV186819	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Mouse) (pPM-C-HA)
PV186820	ABM	500 ng	EUR 603

GRPEL2 Protein Vector (Mouse) (pPM-C-His)
PV186821	ABM	500 ng	EUR 603

Grpel2 3'UTR Luciferase Stable Cell Line
TU205486	ABM	1.0 ml	Ask for price

Grpel2 3'UTR GFP Stable Cell Line
TU159139	ABM	1.0 ml	Ask for price

GRPEL2 3'UTR Luciferase Stable Cell Line
TU009350	ABM	1.0 ml	EUR 2333

Grpel2 3'UTR Luciferase Stable Cell Line
TU109139	ABM	1.0 ml	Ask for price

GRPEL2 3'UTR GFP Stable Cell Line
TU059350	ABM	1.0 ml	EUR 2333

Grpel2 3'UTR GFP Stable Cell Line
TU255486	ABM	1.0 ml	Ask for price

GRPEL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV698803	ABM	1.0 ug DNA	EUR 514

GRPEL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV698807	ABM	1.0 ug DNA	EUR 514

GRPEL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV698808	ABM	1.0 ug DNA	EUR 514