GRPEL2

GRPEL2 siRNA

20-abx918747
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRPEL2 antibody

70R-2426 50 ug
EUR 467
Description: Rabbit polyclonal GRPEL2 antibody

GRPEL2 Antibody

1-CSB-PA819443ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL2. Recognizes GRPEL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-GRPEL2

YF-PA22237 50 ul
EUR 363
Description: Mouse polyclonal to GRPEL2

GRPEL2 Rabbit pAb

A8339-100ul 100 ul
EUR 308

GRPEL2 Rabbit pAb

A8339-200ul 200 ul
EUR 459

GRPEL2 Rabbit pAb

A8339-20ul 20 ul
EUR 183

GRPEL2 Rabbit pAb

A8339-50ul 50 ul
EUR 223

GRPEL2 Blocking Peptide

33R-3717 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRPEL2 antibody, catalog no. 70R-2426

GRPEL2 Polyclonal Antibody

31516-100ul 100ul
EUR 252

GRPEL2 Polyclonal Antibody

31516-50ul 50ul
EUR 187

GRPEL2 cloning plasmid

CSB-CL819443HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atggccgtacggtcgctgtgggcgggccggctgcgggtgcagcgcctactggcctggagtgccgcgtgggagagcaagggatggccgcttccattcagcactgccacccagagaactgctggtgaggactgccgttctgaggaccctcctgatgagcttgggccccctcttgctga
  • Show more
Description: A cloning plasmid for the GRPEL2 gene.

Anti-GRPEL2 antibody

STJ110637 100 µl
EUR 277

GRPEL2 Polyclonal Conjugated Antibody

C31516 100ul
EUR 397

Human GRPEL2 shRNA Plasmid

20-abx965136
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GRPEL2 shRNA Plasmid

20-abx971591
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRPEL2 Recombinant Protein (Human)

RP014065 100 ug Ask for price

GRPEL2 Recombinant Protein (Rat)

RP203762 100 ug Ask for price

GRPEL2 Recombinant Protein (Mouse)

RP140111 100 ug Ask for price

GRPEL2 ORF Vector (Human) (pORF)

ORF004689 1.0 ug DNA
EUR 95

Grpel2 ORF Vector (Rat) (pORF)

ORF067922 1.0 ug DNA
EUR 506

Grpel2 ORF Vector (Mouse) (pORF)

ORF046705 1.0 ug DNA
EUR 506

GRPEL2 sgRNA CRISPR Lentivector set (Human)

K0909801 3 x 1.0 ug
EUR 339

Grpel2 sgRNA CRISPR Lentivector set (Rat)

K6120901 3 x 1.0 ug
EUR 339

Grpel2 sgRNA CRISPR Lentivector set (Mouse)

K3371501 3 x 1.0 ug
EUR 339

GRPEL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0909802 1.0 ug DNA
EUR 154

GRPEL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0909803 1.0 ug DNA
EUR 154

GRPEL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0909804 1.0 ug DNA
EUR 154

GrpE Protein Homolog 2, Mitochondrial (GrpEL2) Antibody

20-abx141558
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody

20-abx005913
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody

abx030831-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody

abx030831-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GrpE Protein Homolog 2, Mitochondrial (GRPEL2) Antibody

20-abx321311
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Grpel2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6120902 1.0 ug DNA
EUR 154

Grpel2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6120903 1.0 ug DNA
EUR 154

Grpel2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6120904 1.0 ug DNA
EUR 154

Grpel2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3371502 1.0 ug DNA
EUR 154

Grpel2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3371503 1.0 ug DNA
EUR 154

Grpel2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3371504 1.0 ug DNA
EUR 154

GRPEL2 Protein Vector (Rat) (pPB-C-His)

PV271686 500 ng
EUR 603

GRPEL2 Protein Vector (Rat) (pPB-N-His)

PV271687 500 ng
EUR 603

GRPEL2 Protein Vector (Rat) (pPM-C-HA)

PV271688 500 ng
EUR 603

GRPEL2 Protein Vector (Rat) (pPM-C-His)

PV271689 500 ng
EUR 603

GRPEL2 Protein Vector (Human) (pPB-C-His)

PV018753 500 ng
EUR 329

GRPEL2 Protein Vector (Human) (pPB-N-His)

PV018754 500 ng
EUR 329

GRPEL2 Protein Vector (Human) (pPM-C-HA)

PV018755 500 ng
EUR 329

GRPEL2 Protein Vector (Human) (pPM-C-His)

PV018756 500 ng
EUR 329

GRPEL2 Protein Vector (Mouse) (pPB-C-His)

PV186818 500 ng
EUR 603

GRPEL2 Protein Vector (Mouse) (pPB-N-His)

PV186819 500 ng
EUR 603

GRPEL2 Protein Vector (Mouse) (pPM-C-HA)

PV186820 500 ng
EUR 603

GRPEL2 Protein Vector (Mouse) (pPM-C-His)

PV186821 500 ng
EUR 603

Grpel2 3'UTR Luciferase Stable Cell Line

TU205486 1.0 ml Ask for price

Grpel2 3'UTR GFP Stable Cell Line

TU159139 1.0 ml Ask for price

GRPEL2 3'UTR Luciferase Stable Cell Line

TU009350 1.0 ml
EUR 2333

Grpel2 3'UTR Luciferase Stable Cell Line

TU109139 1.0 ml Ask for price

GRPEL2 3'UTR GFP Stable Cell Line

TU059350 1.0 ml
EUR 2333

Grpel2 3'UTR GFP Stable Cell Line

TU255486 1.0 ml Ask for price

GRPEL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV698803 1.0 ug DNA
EUR 514

GRPEL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV698807 1.0 ug DNA
EUR 514

GRPEL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV698808 1.0 ug DNA
EUR 514