
Mobile: 0032476375875

Lab Reagentia

Recente artiekels

Bezoek of bel ons


GRPEL1 antibody

70R-17610 50 ul
EUR 435
Description: Rabbit polyclonal GRPEL1 antibody

GRPEL1 antibody

70R-2425 50 ug
EUR 467
Description: Rabbit polyclonal GRPEL1 antibody

GRPEL1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL1. Recognizes GRPEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GRPEL1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL1. Recognizes GRPEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GRPEL1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL1. Recognizes GRPEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21061 50 ug
EUR 363
Description: Mouse polyclonal to GRPEL1

GRPEL1 Polyclonal Antibody

30632-100ul 100ul
EUR 252

GRPEL1 Polyclonal Antibody

30632-50ul 50ul
EUR 187

GRPEL1 Blocking Peptide

33R-6876 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRPEL1 antibody, catalog no. 70R-2425

GRPEL1 cloning plasmid

CSB-CL875707HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggcggctcagtgcgtgaggttggcgcggcgcagtcttcctgctttggcgttgtctctcaggccatctccccggttgttgtgcacagccacgaaacaaaagaacagtggccagaacctggaagaggacatgggtcagagtgaacagaaggcagatcctcctgctacagagaagac
  • Show more
Description: A cloning plasmid for the GRPEL1 gene.

GRPEL1 Rabbit pAb

A4999-100ul 100 ul
EUR 308

GRPEL1 Rabbit pAb

A4999-200ul 200 ul
EUR 459

GRPEL1 Rabbit pAb

A4999-20ul 20 ul
EUR 183

GRPEL1 Rabbit pAb

A4999-50ul 50 ul
EUR 223

anti- GRPEL1 antibody

FNab03666 100µg
EUR 548.75
  • Immunogen: GrpE-like 1, mitochondrial(E. coli)
  • Uniprot ID: Q9HAV7
  • Gene ID: 80273
  • Research Area: Metabolism
Description: Antibody raised against GRPEL1

Anti-GRPEL1 antibody

PAab03666 100 ug
EUR 386

Anti-GRPEL1 antibody

STJ27014 100 µl
EUR 277

GRPEL1 protein (His tag)

80R-1507 50 ug
EUR 305
Description: Purified recombinant Human GRPEL1 protein


EF010004 96 Tests
EUR 689

Mouse GRPEL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GRPEL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRPEL1 Polyclonal Conjugated Antibody

C30632 100ul
EUR 397

Human GRPEL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRPEL1 Recombinant Protein (Human)

RP014062 100 ug Ask for price

GRPEL1 Recombinant Protein (Rat)

RP203759 100 ug Ask for price

GRPEL1 Recombinant Protein (Mouse)

RP140108 100 ug Ask for price

Grpel1 ORF Vector (Rat) (pORF)

ORF067921 1.0 ug DNA
EUR 506

GRPEL1 ORF Vector (Human) (pORF)

ORF004688 1.0 ug DNA
EUR 95

Grpel1 ORF Vector (Mouse) (pORF)

ORF046704 1.0 ug DNA
EUR 506

Grpel1 sgRNA CRISPR Lentivector set (Mouse)

K4800401 3 x 1.0 ug
EUR 339

Grpel1 sgRNA CRISPR Lentivector set (Rat)

K7012501 3 x 1.0 ug
EUR 339

GRPEL1 sgRNA CRISPR Lentivector set (Human)

K0909701 3 x 1.0 ug
EUR 339

Human GrpE protein homolog 1, mitochondrial (GRPEL1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human GrpE protein homolog 1, mitochondrial(GRPEL1) expressed in E.coli

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx036628-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx029915-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx029915-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx233666-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Grpel1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4800402 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4800403 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4800404 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7012502 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7012503 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7012504 1.0 ug DNA
EUR 154

GRPEL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0909702 1.0 ug DNA
EUR 154

GRPEL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0909703 1.0 ug DNA
EUR 154

GRPEL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0909704 1.0 ug DNA
EUR 154

GRPEL1 GrpE-Like 1 Human Recombinant Protein

PROTQ9HAV7 Regular: 10ug
EUR 317
Description: GRPEL1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 211 amino acids (28-217a.a.) and having a molecular mass of 23.6kDa.;GRPEL1 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRPEL1 Protein Vector (Rat) (pPB-C-His)

PV271682 500 ng
EUR 603

GRPEL1 Protein Vector (Rat) (pPB-N-His)

PV271683 500 ng
EUR 603

GRPEL1 Protein Vector (Rat) (pPM-C-HA)

PV271684 500 ng
EUR 603

GRPEL1 Protein Vector (Rat) (pPM-C-His)

PV271685 500 ng
EUR 603

GRPEL1 Protein Vector (Mouse) (pPB-C-His)

PV186814 500 ng
EUR 603

GRPEL1 Protein Vector (Mouse) (pPB-N-His)

PV186815 500 ng
EUR 603