  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 antibody

70R-49798 100 ul
EUR 244
Description: Purified Polyclonal GNAI1 antibody

GNAI1 antibody

31909-100ul 100ul
EUR 252

GNAI1 antibody

31909-50ul 50ul
EUR 187

GNAI1 antibody

70R-17519 50 ul
EUR 435
Description: Rabbit polyclonal GNAI1 antibody

GNAI1 antibody

70R-2047 50 ug
EUR 467
Description: Rabbit polyclonal GNAI1 antibody

GNAI1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAI1. Recognizes GNAI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNAI1 cloning plasmid

CSB-CL009588HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaag
  • Show more
Description: A cloning plasmid for the GNAI1 gene.

GNAI1 Polyclonal Antibody

ES11882-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNAI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNAI1 Polyclonal Antibody

ES11882-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNAI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- GNAI1 antibody

FNab03531 100µg
EUR 505.25
  • Immunogen: guanine nucleotide binding protein(G protein), alpha inhibiting activity polypeptide 1
  • Uniprot ID: P63096
  • Gene ID: 2770
  • Research Area: Signal Transduction
Description: Antibody raised against GNAI1

GNAI1 Polyclonal Antibody

ABP58653-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

GNAI1 Polyclonal Antibody

ABP58653-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

GNAI1 Polyclonal Antibody

ABP58653-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

GNAI1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GNAI1 Rabbit pAb

A17388-100ul 100 ul Ask for price

GNAI1 Rabbit pAb

A17388-200ul 200 ul Ask for price

GNAI1 Rabbit pAb

A17388-20ul 20 ul Ask for price

GNAI1 Rabbit pAb

A17388-50ul 50 ul
EUR 384

GNAI1 Rabbit pAb

A8844-100ul 100 ul
EUR 308

GNAI1 Rabbit pAb

A8844-200ul 200 ul
EUR 459

GNAI1 Rabbit pAb

A8844-20ul 20 ul
EUR 183

GNAI1 Rabbit pAb

A8844-50ul 50 ul
EUR 223

GNAI1 Blocking Peptide

33R-10215 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI1 antibody, catalog no. 70R-2047

GNAI1 Polyclonal Antibody

31642-100ul 100ul
EUR 252

GNAI1 Polyclonal Antibody

31642-50ul 50ul
EUR 187

Anti-GNAI1 antibody

PAab03531 100 ug
EUR 355

pBluescriptR-GNAI1 Plasmid

PVT17029 2 ug
EUR 325

Anti-GNAI1 antibody

STJ119511 50 µl
EUR 393
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI1 antibody

STJ116332 100 µl
EUR 277
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI1 antibody

STJ193040 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNAI1

GNAI1 Polyclonal Conjugated Antibody

C31642 100ul
EUR 397

GNAI1 Polyclonal Conjugated Antibody

C31909 100ul
EUR 397

Rat GNAI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-08736c 96 Tests
EUR 928


ELI-27342b 96 Tests
EUR 928


EF009906 96 Tests
EUR 689

Mouse Gnai1 ELISA KIT

ELI-43677m 96 Tests
EUR 865


ELI-38025h 96 Tests
EUR 824

GNAI1 protein (His tag)

80R-1980 50 ug
EUR 322
Description: Recombinant human GNAI1 protein (His tag)

Mouse GNAI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAI1 Recombinant Protein (Human)

RP013462 100 ug Ask for price

GNAI1 Recombinant Protein (Rat)

RP202943 100 ug Ask for price

GNAI1 Recombinant Protein (Mouse)

RP138896 100 ug Ask for price

GNAI1 ORF Vector (Human) (pORF)

ORF004488 1.0 ug DNA
EUR 95

Gnai1 ORF Vector (Rat) (pORF)

ORF067649 1.0 ug DNA
EUR 506

Gnai1 ORF Vector (Mouse) (pORF)

ORF046300 1.0 ug DNA
EUR 506

GNAI1 sgRNA CRISPR Lentivector set (Human)

K0874501 3 x 1.0 ug
EUR 339

Gnai1 sgRNA CRISPR Lentivector set (Mouse)

K3829301 3 x 1.0 ug
EUR 339

Gnai1 sgRNA CRISPR Lentivector set (Rat)

K6775801 3 x 1.0 ug
EUR 339

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0874502 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0874503 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0874504 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3829302 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3829303 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3829304 1.0 ug DNA
EUR 154