GALNT2

GALNT2 siRNA

20-abx917537
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT2 antibody

22999-100ul 100ul
EUR 390

GALNT2 antibody

70R-12773 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GALNT2 antibody

GALNT2 Antibody

1-CSB-PA605995ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT2. Recognizes GALNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GALNT2 Antibody

1-CSB-PA605995ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT2. Recognizes GALNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-GALNT2

YF-PA23758 50 ul
EUR 334
Description: Mouse polyclonal to GALNT2

GALNT2 cloning plasmid

CSB-CL605995HU-10ug 10ug
EUR 590
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1716
  • Sequence: atgcggcggcgctcgcggatgctgctctgcttcgccttcctgtgggtgctgggcatcgcctactacatgtactcggggggcggctctgcgctggccgggggcgcgggcggcggcgccggcaggaaggaggactggaatgaaattgaccccattaaaaagaaagaccttcatcaca
  • Show more
Description: A cloning plasmid for the GALNT2 gene.

GALNT2 Rabbit pAb

A6910-100ul 100 ul
EUR 308

GALNT2 Rabbit pAb

A6910-200ul 200 ul
EUR 459

GALNT2 Rabbit pAb

A6910-20ul 20 ul
EUR 183

GALNT2 Rabbit pAb

A6910-50ul 50 ul
EUR 223

GALNT2 Polyclonal Antibody

30753-100ul 100ul
EUR 252

GALNT2 Polyclonal Antibody

30753-50ul 50ul
EUR 187

Anti-GALNT2 antibody

STJ28990 100 µl
EUR 277
Description: This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants.

GALNT2 Polyclonal Conjugated Antibody

C30753 100ul
EUR 397

Mouse GALNT2 shRNA Plasmid

20-abx979900
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Galnt2 ELISA KIT

ELI-27200m 96 Tests
EUR 865

Human GALNT2 ELISA KIT

ELI-37627h 96 Tests
EUR 824

Human GALNT2 shRNA Plasmid

20-abx951725
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALNT2 Recombinant Protein (Human)

RP012877 100 ug Ask for price

pCMV-SPORT6-GALNT2 Plasmid

PVT16800 2 ug
EUR 325

GALNT2 Recombinant Protein (Rat)

RP202169 100 ug Ask for price

GALNT2 Recombinant Protein (Mouse)

RP135830 100 ug Ask for price

GALNT2 ORF Vector (Human) (pORF)

ORF004293 1.0 ug DNA
EUR 95

Galnt2 ORF Vector (Rat) (pORF)

ORF067391 1.0 ug DNA
EUR 506

Galnt2 ORF Vector (Mouse) (pORF)

ORF045278 1.0 ug DNA
EUR 506

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody

abx146093-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody

abx034331-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody

abx034331-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody

20-abx005253
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody

20-abx320821
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody

20-abx321833
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galnt2 sgRNA CRISPR Lentivector set (Rat)

K6224901 3 x 1.0 ug
EUR 339

GALNT2 sgRNA CRISPR Lentivector set (Human)

K0835201 3 x 1.0 ug
EUR 339

Galnt2 sgRNA CRISPR Lentivector set (Mouse)

K4901101 3 x 1.0 ug
EUR 339

p3*FLAG-Myc-CMV-GALNT2 Plasmid

PVTB00200-2a 2 ug
EUR 356

Galnt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6224902 1.0 ug DNA
EUR 154

Galnt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6224903 1.0 ug DNA
EUR 154

Galnt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6224904 1.0 ug DNA
EUR 154

GALNT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0835202 1.0 ug DNA
EUR 154

GALNT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0835203 1.0 ug DNA
EUR 154

GALNT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0835204 1.0 ug DNA
EUR 154

Galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4901102 1.0 ug DNA
EUR 154

Galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4901103 1.0 ug DNA
EUR 154

Galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4901104 1.0 ug DNA
EUR 154

GALNT2 Protein Vector (Rat) (pPB-C-His)

PV269562 500 ng
EUR 603

GALNT2 Protein Vector (Rat) (pPB-N-His)

PV269563 500 ng
EUR 603

GALNT2 Protein Vector (Rat) (pPM-C-HA)

PV269564 500 ng
EUR 603

GALNT2 Protein Vector (Rat) (pPM-C-His)

PV269565 500 ng
EUR 603

GALNT2 Protein Vector (Mouse) (pPB-C-His)

PV181110 500 ng
EUR 603

GALNT2 Protein Vector (Mouse) (pPB-N-His)

PV181111 500 ng
EUR 603

GALNT2 Protein Vector (Mouse) (pPM-C-HA)

PV181112 500 ng
EUR 603

GALNT2 Protein Vector (Mouse) (pPM-C-His)

PV181113 500 ng
EUR 603

GALNT2 Protein Vector (Human) (pPB-C-His)

PV017169 500 ng
EUR 329

GALNT2 Protein Vector (Human) (pPB-N-His)

PV017170 500 ng
EUR 329

GALNT2 Protein Vector (Human) (pPM-C-HA)

PV017171 500 ng
EUR 329

GALNT2 Protein Vector (Human) (pPM-C-His)

PV017172 500 ng
EUR 329

Galnt2 3'UTR Luciferase Stable Cell Line

TU204928 1.0 ml Ask for price

Galnt2 3'UTR GFP Stable Cell Line

TU156885 1.0 ml Ask for price

GALNT2 3'UTR Luciferase Stable Cell Line

TU008521 1.0 ml
EUR 1521

Galnt2 3'UTR Luciferase Stable Cell Line

TU106885 1.0 ml Ask for price

GALNT2 3'UTR GFP Stable Cell Line

TU058521 1.0 ml
EUR 1521

Galnt2 3'UTR GFP Stable Cell Line

TU254928 1.0 ml Ask for price

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6224905 3 x 1.0 ug
EUR 376

GALNT2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0835205 3 x 1.0 ug
EUR 376

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4901105 3 x 1.0 ug
EUR 376

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6224906 1.0 ug DNA
EUR 167

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6224907 1.0 ug DNA
EUR 167

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6224908 1.0 ug DNA
EUR 167

GALNT2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0835206 1.0 ug DNA
EUR 167