GALNT2 antibody
70R-12773	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GALNT2 antibody

GALNT2 Antibody
1-CSB-PA605995ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT2. Recognizes GALNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GALNT2 Antibody
1-CSB-PA605995ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT2. Recognizes GALNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GALNT2 siRNA
20-abx917536	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT2 siRNA
20-abx917537	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GALNT2
YF-PA23758	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GALNT2

GALNT2 Polyclonal Antibody
30753-100ul	SAB	100ul	EUR 252

GALNT2 Polyclonal Antibody
30753-50ul	SAB	50ul	EUR 187

GALNT2 cloning plasmid
CSB-CL605995HU-10ug	Cusabio	10ug	EUR 590
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1716 Sequence: atgcggcggcgctcgcggatgctgctctgcttcgccttcctgtgggtgctgggcatcgcctactacatgtactcggggggcggctctgcgctggccgggggcgcgggcggcggcgccggcaggaaggaggactggaatgaaattgaccccattaaaaagaaagaccttcatcaca Show more
Description: A cloning plasmid for the GALNT2 gene.

GALNT2 Rabbit pAb
A6910-100ul	Abclonal	100 ul	EUR 308

GALNT2 Rabbit pAb
A6910-200ul	Abclonal	200 ul	EUR 459

GALNT2 Rabbit pAb
A6910-20ul	Abclonal	20 ul	EUR 183

GALNT2 Rabbit pAb
A6910-50ul	Abclonal	50 ul	EUR 223

Anti-GALNT2 antibody
STJ28990	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants.

Mouse Galnt2 ELISA KIT
ELI-27200m	Lifescience Market	96 Tests	EUR 865

GALNT2 Polyclonal Conjugated Antibody
C30753	SAB	100ul	EUR 397

Human GALNT2 shRNA Plasmid
20-abx951725	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GALNT2 shRNA Plasmid
20-abx979900	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GALNT2 ELISA KIT
ELI-37627h	Lifescience Market	96 Tests	EUR 824

pCMV-SPORT6-GALNT2 Plasmid
PVT16800	Lifescience Market	2 ug	EUR 325

GALNT2 Recombinant Protein (Human)
RP012877	ABM	100 ug	Ask for price

GALNT2 Recombinant Protein (Rat)
RP202169	ABM	100 ug	Ask for price

GALNT2 Recombinant Protein (Mouse)
RP135830	ABM	100 ug	Ask for price

Galnt2 ORF Vector (Rat) (pORF)
ORF067391	ABM	1.0 ug DNA	EUR 506

GALNT2 ORF Vector (Human) (pORF)
ORF004293	ABM	1.0 ug DNA	EUR 95

Galnt2 ORF Vector (Mouse) (pORF)
ORF045278	ABM	1.0 ug DNA	EUR 506

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody
20-abx005253	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody
abx146093-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody
abx034331-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody
abx034331-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody
20-abx320821	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 2 (GALNT2) Antibody
20-abx321833	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Galnt2 sgRNA CRISPR Lentivector set (Mouse)
K4901101	ABM	3 x 1.0 ug	EUR 339

Galnt2 sgRNA CRISPR Lentivector set (Rat)
K6224901	ABM	3 x 1.0 ug	EUR 339

GALNT2 sgRNA CRISPR Lentivector set (Human)
K0835201	ABM	3 x 1.0 ug	EUR 339

p3*FLAG-Myc-CMV-GALNT2 Plasmid
PVTB00200-2a	Lifescience Market	2 ug	EUR 356

Galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4901102	ABM	1.0 ug DNA	EUR 154

Galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4901103	ABM	1.0 ug DNA	EUR 154

Galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4901104	ABM	1.0 ug DNA	EUR 154

Galnt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6224902	ABM	1.0 ug DNA	EUR 154

Galnt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6224903	ABM	1.0 ug DNA	EUR 154

Galnt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6224904	ABM	1.0 ug DNA	EUR 154

GALNT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0835202	ABM	1.0 ug DNA	EUR 154

GALNT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0835203	ABM	1.0 ug DNA	EUR 154

GALNT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0835204	ABM	1.0 ug DNA	EUR 154

GALNT2 Protein Vector (Rat) (pPB-C-His)
PV269562	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Rat) (pPB-N-His)
PV269563	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Rat) (pPM-C-HA)
PV269564	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Rat) (pPM-C-His)
PV269565	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Mouse) (pPB-C-His)
PV181110	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Mouse) (pPB-N-His)
PV181111	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Mouse) (pPM-C-HA)
PV181112	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Mouse) (pPM-C-His)
PV181113	ABM	500 ng	EUR 603

GALNT2 Protein Vector (Human) (pPB-C-His)
PV017169	ABM	500 ng	EUR 329

GALNT2 Protein Vector (Human) (pPB-N-His)
PV017170	ABM	500 ng	EUR 329

GALNT2 Protein Vector (Human) (pPM-C-HA)
PV017171	ABM	500 ng	EUR 329

GALNT2 Protein Vector (Human) (pPM-C-His)
PV017172	ABM	500 ng	EUR 329

Galnt2 3'UTR Luciferase Stable Cell Line
TU106885	ABM	1.0 ml	Ask for price

Galnt2 3'UTR GFP Stable Cell Line
TU156885	ABM	1.0 ml	Ask for price

Galnt2 3'UTR Luciferase Stable Cell Line
TU204928	ABM	1.0 ml	Ask for price

Galnt2 3'UTR GFP Stable Cell Line
TU254928	ABM	1.0 ml	Ask for price

GALNT2 3'UTR GFP Stable Cell Line
TU058521	ABM	1.0 ml	EUR 1521

GALNT2 3'UTR Luciferase Stable Cell Line
TU008521	ABM	1.0 ml	EUR 1521

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4901105	ABM	3 x 1.0 ug	EUR 376

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6224905	ABM	3 x 1.0 ug	EUR 376

GALNT2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0835205	ABM	3 x 1.0 ug	EUR 376

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4901106	ABM	1.0 ug DNA	EUR 167

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4901107	ABM	1.0 ug DNA	EUR 167

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4901108	ABM	1.0 ug DNA	EUR 167

Galnt2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6224906	ABM	1.0 ug DNA	EUR 167