FBXW4

FBXW4 siRNA

20-abx916665
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW4 Antibody

39899-100ul 100ul
EUR 390

FBXW4 antibody

70R-17269 50 ul
EUR 435
Description: Rabbit polyclonal FBXW4 antibody

FBXW4 Antibody

1-CSB-PA008525ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW4. Recognizes FBXW4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FBXW4 Antibody

1-CSB-PA008525ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW4. Recognizes FBXW4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW4 Antibody

1-CSB-PA008525GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW4. Recognizes FBXW4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

FBXW4 cloning plasmid

CSB-CL008525HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atgccctggatgcagctagaggatgattctctgtacatatcccaggctaatttcatcctggcctaccagttccgtccagatggtgccagcttgaatcgtcggcctctgggagtctttgctgggcatgatgaggacgtttgccactttgtgctggccaactcgcatattgttagtgc
  • Show more
Description: A cloning plasmid for the FBXW4 gene.

anti- FBXW4 antibody

FNab03055 100µg
EUR 505.25
  • Immunogen: F-box and WD repeat domain containing 4
  • Uniprot ID: P57775
  • Gene ID: 6468
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against FBXW4

FBXW4 Rabbit pAb

A8149-100ul 100 ul
EUR 308

FBXW4 Rabbit pAb

A8149-200ul 200 ul
EUR 459

FBXW4 Rabbit pAb

A8149-20ul 20 ul
EUR 183

FBXW4 Rabbit pAb

A8149-50ul 50 ul
EUR 223

FBXW4 Polyclonal Antibody

31453-100ul 100ul
EUR 252

FBXW4 Polyclonal Antibody

31453-50ul 50ul
EUR 187

Anti-FBXW4 antibody

PAab03055 100 ug
EUR 355

Anti-FBXW4 Antibody

STJ500990 100 µg
EUR 476

Anti-FBXW4 antibody

STJ110448 100 µl
EUR 277
Description: This gene is a member of the F-box/WD-40 gene family, which recruit specific target proteins through their WD-40 protein-protein binding domains for ubiquitin mediated degradation. In mouse, a highly similar protein is thought to be responsible for maintaining the apical ectodermal ridge of developing limb buds; disruption of the mouse gene results in the absence of central digits, underdeveloped or absent metacarpal/metatarsal bones and syndactyly. This phenotype is remarkably similar to split hand-split foot malformation in humans, a clinically heterogeneous condition with a variety of modes of transmission. An autosomal recessive form has been mapped to the chromosomal region where this gene is located, and complex rearrangements involving duplications of this gene and others have been associated with the condition. A pseudogene of this locus has been mapped to one of the introns of the BCR gene on chromosome 22.

FBXW4 Polyclonal Conjugated Antibody

C31453 100ul
EUR 397

Mouse FBXW4 shRNA Plasmid

20-abx974030
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW4 ELISA KIT|Human

EF009596 96 Tests
EUR 689

Human FBXW4 shRNA Plasmid

20-abx954371
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW4 Recombinant Protein (Human)

RP011962 100 ug Ask for price

FBXW4 Recombinant Protein (Rat)

RP201077 100 ug Ask for price

FBXW4 Recombinant Protein (Mouse)

RP134153 100 ug Ask for price

Anti-FBXW4 Antibody (Biotin)

STJ500991 100 µg
EUR 586

Anti-FBXW4 Antibody (FITC)

STJ500992 100 µg
EUR 586

FBXW4 ORF Vector (Human) (pORF)

ORF003988 1.0 ug DNA
EUR 95

Fbxw4 ORF Vector (Rat) (pORF)

ORF067027 1.0 ug DNA
EUR 506

Fbxw4 ORF Vector (Mouse) (pORF)

ORF044719 1.0 ug DNA
EUR 506

Polyclonal SHFM3 / FBXW4 Antibody (aa5-186)

APR03106G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SHFM3 / FBXW4 (aa5-186). This antibody is tested and proven to work in the following applications:

FBXW4 sgRNA CRISPR Lentivector set (Human)

K0767301 3 x 1.0 ug
EUR 339

Fbxw4 sgRNA CRISPR Lentivector set (Mouse)

K4684801 3 x 1.0 ug
EUR 339

Fbxw4 sgRNA CRISPR Lentivector set (Rat)

K6151401 3 x 1.0 ug
EUR 339

FBXW4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767302 1.0 ug DNA
EUR 154

FBXW4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767303 1.0 ug DNA
EUR 154

FBXW4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767304 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4684802 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4684803 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4684804 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6151402 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6151403 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6151404 1.0 ug DNA
EUR 154

FBXW4 Protein Vector (Mouse) (pPB-C-His)

PV178874 500 ng
EUR 603

FBXW4 Protein Vector (Mouse) (pPB-N-His)

PV178875 500 ng
EUR 603

FBXW4 Protein Vector (Mouse) (pPM-C-HA)

PV178876 500 ng
EUR 603

FBXW4 Protein Vector (Mouse) (pPM-C-His)

PV178877 500 ng
EUR 603

FBXW4 Protein Vector (Human) (pPB-C-His)

PV015949 500 ng
EUR 329

FBXW4 Protein Vector (Human) (pPB-N-His)

PV015950 500 ng
EUR 329

FBXW4 Protein Vector (Human) (pPM-C-HA)

PV015951 500 ng
EUR 329

FBXW4 Protein Vector (Human) (pPM-C-His)

PV015952 500 ng
EUR 329

FBXW4 Protein Vector (Rat) (pPB-C-His)

PV268106 500 ng
EUR 603

FBXW4 Protein Vector (Rat) (pPB-N-His)

PV268107 500 ng
EUR 603

FBXW4 Protein Vector (Rat) (pPM-C-HA)

PV268108 500 ng
EUR 603

FBXW4 Protein Vector (Rat) (pPM-C-His)

PV268109 500 ng
EUR 603

Fbxw4 3'UTR Luciferase Stable Cell Line

TU204531 1.0 ml Ask for price

Fbxw4 3'UTR GFP Stable Cell Line

TU156464 1.0 ml Ask for price

FBXW4 3'UTR Luciferase Stable Cell Line

TU007810 1.0 ml
EUR 1394

Fbxw4 3'UTR Luciferase Stable Cell Line

TU106464 1.0 ml Ask for price

FBXW4 3'UTR GFP Stable Cell Line

TU057810 1.0 ml
EUR 1394

Fbxw4 3'UTR GFP Stable Cell Line

TU254531 1.0 ml Ask for price

FBXW4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791629 1.0 ug DNA
EUR 316

FBXW4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791630 1.0 ug DNA
EUR 316

Human F-box/WD repeat-containing protein 4 (FBXW4)

1-CSB-EP008525HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human F-box/WD repeat-containing protein 4(FBXW4) expressed in E.coli

FBXW4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0767305 3 x 1.0 ug
EUR 376

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

20-abx112493
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

abx037921-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

20-abx005895
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

abx031451-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

abx031451-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

20-abx320507
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.