EXOC7

EXOC7 siRNA

20-abx901799
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC7 siRNA

20-abx915810
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC7 siRNA

20-abx915811
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC7 antibody

22034-100ul 100ul
EUR 390

EXOC7 antibody

22233-100ul 100ul
EUR 390

EXOC7 antibody

70R-17171 50 ul
EUR 435
Description: Rabbit polyclonal EXOC7 antibody

EXOC7 antibody

70R-13469 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EXOC7 antibody

EXOC7 antibody

70R-13474 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EXOC7 antibody

EXOC7 Antibody

1-CSB-PA007886GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXOC7 Antibody

1-CSB-PA007886LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200

pENTR223- EXOC7

PVT11498 2 ug
EUR 273

anti-EXOC7

YF-PA25859 50 ul
EUR 334
Description: Mouse polyclonal to EXOC7

EXOC7 cloning plasmid

CSB-CL007886HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgaggccctgggttgccgtgctctcgctgttcccctctcggggctgggctggggccgctcttggccccaaggttgccccgggccagcagcccagccagcagcacagtctctatggtgctgaggaagagcagcagcagcaggatggtgaagtagtaaactgggggaggcagggcac
  • Show more
Description: A cloning plasmid for the EXOC7 gene.

EXOC7 cloning plasmid

CSB-CL007886HU2-10ug 10ug
EUR 685
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2055
  • Sequence: atgattcccccacaggaggcatccgctcgacggcgggagattgaggacaagctgaagcaggaggaggagactctgtccttcatccgagacagcctggagaagagcgaccagctcactaagaacatggtgtctatcttatcatcctttgagagccgccttatgaagctggagaact
  • Show more
Description: A cloning plasmid for the EXOC7 gene.

Anti-EXOC7 antibody

STJ70915 100 µg
EUR 359

Anti-EXOC7 (1B7)

YF-MA17831 100 ug
EUR 363
Description: Mouse monoclonal to EXOC7

Anti-EXOC7 (1D4)

YF-MA11400 100 ug
EUR 363
Description: Mouse monoclonal to EXOC7

Polyclonal EXOC7 Antibody (Internal)

APR15894G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EXOC7 (Internal). This antibody is tested and proven to work in the following applications:

Mouse EXOC7 shRNA Plasmid

20-abx974339
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EXOC7 shRNA Plasmid

20-abx986321
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EXOC7 shRNA Plasmid

20-abx958136
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC7 Antibody, HRP conjugated

1-CSB-PA007886LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXOC7 Antibody, FITC conjugated

1-CSB-PA007886LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXOC7 Antibody, Biotin conjugated

1-CSB-PA007886LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXOC7 Recombinant Protein (Human)

RP011050 100 ug Ask for price

EXOC7 Recombinant Protein (Human)

RP011053 100 ug Ask for price

EXOC7 Recombinant Protein (Rat)

RP200102 100 ug Ask for price

EXOC7 Recombinant Protein (Mouse)

RP132488 100 ug Ask for price

EXOC7 Recombinant Protein (Mouse)

RP132491 100 ug Ask for price

Polyclonal Goat Anti-EXOC7 Antibody

APR16277G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EXOC7 . This antibody is tested and proven to work in the following applications:

EXOC7 ORF Vector (Human) (pORF)

ORF003684 1.0 ug DNA
EUR 95

EXOC7 ORF Vector (Human) (pORF)

ORF003685 1.0 ug DNA
EUR 95

Exoc7 ORF Vector (Rat) (pORF)

ORF066702 1.0 ug DNA
EUR 506

Exoc7 ORF Vector (Mouse) (pORF)

ORF044164 1.0 ug DNA
EUR 506

Exoc7 ORF Vector (Mouse) (pORF)

ORF044165 1.0 ug DNA
EUR 506

Exocyst Complex Component 7 (EXOC7) Antibody

20-abx112407
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 7 (EXOC7) Antibody

abx432668-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Exoc7 sgRNA CRISPR Lentivector set (Mouse)

K3473501 3 x 1.0 ug
EUR 339

EXOC7 sgRNA CRISPR Lentivector set (Human)

K0703001 3 x 1.0 ug
EUR 339

Exoc7 sgRNA CRISPR Lentivector set (Rat)

K6978501 3 x 1.0 ug
EUR 339

Monoclonal EXOC7 Antibody (monoclonal) (M01), Clone: 1D4

APR15895G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EXOC7 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1D4. This antibody is applicable in WB and IHC, E

Exoc7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3473502 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3473503 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3473504 1.0 ug DNA
EUR 154

EXOC7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0703002 1.0 ug DNA
EUR 154

EXOC7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0703003 1.0 ug DNA
EUR 154

EXOC7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0703004 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6978502 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6978503 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6978504 1.0 ug DNA
EUR 154

EXOC7 Protein Vector (Mouse) (pPB-C-His)

PV176654 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPB-N-His)

PV176655 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPM-C-HA)

PV176656 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPM-C-His)

PV176657 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPB-C-His)

PV176658 500 ng
EUR 1065

EXOC7 Protein Vector (Mouse) (pPB-N-His)

PV176659 500 ng
EUR 1065

EXOC7 Protein Vector (Mouse) (pPM-C-HA)

PV176660 500 ng
EUR 1065

EXOC7 Protein Vector (Mouse) (pPM-C-His)

PV176661 500 ng
EUR 1065

EXOC7 Protein Vector (Human) (pPB-C-His)

PV014733 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPB-N-His)

PV014734 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-HA)

PV014735 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-His)

PV014736 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPB-C-His)

PV014737 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPB-N-His)

PV014738 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-HA)

PV014739 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-His)

PV014740 500 ng
EUR 329

EXOC7 Protein Vector (Rat) (pPB-C-His)

PV266806 500 ng
EUR 603

EXOC7 Protein Vector (Rat) (pPB-N-His)

PV266807 500 ng
EUR 603

EXOC7 Protein Vector (Rat) (pPM-C-HA)

PV266808 500 ng
EUR 603

EXOC7 Protein Vector (Rat) (pPM-C-His)

PV266809 500 ng
EUR 603