
Mobile: 0032476375875

Lab Reagentia

Recente artiekels

Bezoek of bel ons


EXOC5 antibody

70R-17169 50 ul
EUR 435
Description: Rabbit polyclonal EXOC5 antibody

EXOC5 Antibody

DF12397 200ul
EUR 304
Description: EXOC5 antibody detects endogenous levels of EXOC5.

EXOC5 antibody

70R-3820 50 ug
EUR 467
Description: Rabbit polyclonal EXOC5 antibody raised against the N terminal of EXOC5

EXOC5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EXOC5. Recognizes EXOC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17125 50 ul
EUR 363
Description: Mouse polyclonal to EXOC5


YF-PA17126 50 ug
EUR 363
Description: Mouse polyclonal to EXOC5

EXOC5 Blocking Peptide

33R-1562 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC5 antibody, catalog no. 70R-3820

EXOC5 Polyclonal Antibody

31695-100ul 100ul
EUR 252

EXOC5 Polyclonal Antibody

31695-50ul 50ul
EUR 187

EXOC5 Blocking Peptide

DF12397-BP 1mg
EUR 195

EXOC5 cloning plasmid

CSB-CL007883HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2127
  • Sequence: atggctaccacggccgagctcttcgaggagccttttgtggcagatgaatatattgaacgtcttgtatggagaaccccaggaggaggctctagaggtggacctgaagcttttgatcctaaaagattattagaagaatttgtaaatcatattcaggaactccagataatggatgaaa
  • Show more
Description: A cloning plasmid for the EXOC5 gene.

EXOC5 Rabbit pAb

A9282-100ul 100 ul
EUR 308

EXOC5 Rabbit pAb

A9282-200ul 200 ul
EUR 459

EXOC5 Rabbit pAb

A9282-20ul 20 ul
EUR 183

EXOC5 Rabbit pAb

A9282-50ul 50 ul
EUR 223

anti- EXOC5 antibody

FNab02894 100µg
EUR 505.25
  • Immunogen: exocyst complex component 5
  • Uniprot ID: O00471
  • Gene ID: 10640
  • Research Area: Signal Transduction
Description: Antibody raised against EXOC5

Anti-EXOC5 antibody

PAab02894 100 ug
EUR 355

Anti-EXOC5 antibody

STJ111636 100 µl
EUR 277
Description: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity.


EF009473 96 Tests
EUR 689

Rat EXOC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC5 Polyclonal Conjugated Antibody

C31695 100ul
EUR 397

Human EXOC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EXOC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16778 2 ug
EUR 325

EXOC5 Recombinant Protein (Human)

RP011044 100 ug Ask for price

EXOC5 Recombinant Protein (Rat)

RP200093 100 ug Ask for price

EXOC5 Recombinant Protein (Mouse)

RP132479 100 ug Ask for price

Polyclonal EXOC5 Antibody (C-term)

APR15892G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXOC5 (C-term). This antibody is tested and proven to work in the following applications:

Exoc5 ORF Vector (Rat) (pORF)

ORF066699 1.0 ug DNA
EUR 506

EXOC5 ORF Vector (Human) (pORF)

ORF003682 1.0 ug DNA
EUR 95

Exoc5 ORF Vector (Mouse) (pORF)

ORF044161 1.0 ug DNA
EUR 506

Exocyst Complex Component 5 (EXOC5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 5 (EXOC5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 5 (EXOC5) Antibody

abx232894-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

EXOC5 sgRNA CRISPR Lentivector set (Human)

K0702701 3 x 1.0 ug
EUR 339

Exoc5 sgRNA CRISPR Lentivector set (Rat)

K6796501 3 x 1.0 ug
EUR 339

Exoc5 sgRNA CRISPR Lentivector set (Mouse)

K4556201 3 x 1.0 ug
EUR 339

EXOC5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0702702 1.0 ug DNA
EUR 154

EXOC5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0702703 1.0 ug DNA
EUR 154

EXOC5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0702704 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6796502 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6796503 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6796504 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4556202 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4556203 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4556204 1.0 ug DNA
EUR 154

EXOC5 Protein Vector (Mouse) (pPB-C-His)

PV176642 500 ng
EUR 1065

EXOC5 Protein Vector (Mouse) (pPB-N-His)

PV176643 500 ng
EUR 1065

EXOC5 Protein Vector (Mouse) (pPM-C-HA)

PV176644 500 ng
EUR 1065

EXOC5 Protein Vector (Mouse) (pPM-C-His)

PV176645 500 ng
EUR 1065

EXOC5 Protein Vector (Rat) (pPB-C-His)

PV266794 500 ng
EUR 1166

EXOC5 Protein Vector (Rat) (pPB-N-His)

PV266795 500 ng
EUR 1166

EXOC5 Protein Vector (Rat) (pPM-C-HA)

PV266796 500 ng
EUR 1166

EXOC5 Protein Vector (Rat) (pPM-C-His)

PV266797 500 ng
EUR 1166

EXOC5 Protein Vector (Human) (pPB-C-His)

PV014725 500 ng
EUR 329

EXOC5 Protein Vector (Human) (pPB-N-His)

PV014726 500 ng
EUR 329

EXOC5 Protein Vector (Human) (pPM-C-HA)

PV014727 500 ng
EUR 329

EXOC5 Protein Vector (Human) (pPM-C-His)

PV014728 500 ng
EUR 329

Exoc5 3'UTR GFP Stable Cell Line

TU156010 1.0 ml Ask for price

Exoc5 3'UTR Luciferase Stable Cell Line

TU106010 1.0 ml Ask for price

Exoc5 3'UTR Luciferase Stable Cell Line

TU204152 1.0 ml Ask for price

Exoc5 3'UTR GFP Stable Cell Line

TU254152 1.0 ml Ask for price

EXOC5 3'UTR GFP Stable Cell Line

TU057123 1.0 ml
EUR 4617

EXOC5 3'UTR Luciferase Stable Cell Line

TU007123 1.0 ml
EUR 4617

Human Exocyst complex component 5, EXOC5 ELISA KIT

ELI-20567h 96 Tests
EUR 824

Human Exocyst Complex Component 5 (EXOC5) ELISA Kit

abx387215-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Exocyst complex component 5, Exoc5 ELISA KIT

ELI-47670m 96 Tests
EUR 865