esam

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

DLR-ESAM-Hu-96T 96T
EUR 673
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-48Tests 48 Tests
EUR 544

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-96Tests 96 Tests
EUR 756

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-48Tests 48 Tests
EUR 521

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-96Tests 96 Tests
EUR 723

Esam/ Rat Esam ELISA Kit

ELI-20559r 96 Tests
EUR 886

ESAM antibody

70R-17149 50 ul
EUR 435
Description: Rabbit polyclonal ESAM antibody

ESAM Antibody

1-CSB-PA850258LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESAM Antibody

1-CSB-PA007818GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ESAM siRNA

20-abx901776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ESAM siRNA

20-abx915678
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ESAM siRNA

20-abx915679
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ESAM

YF-PA21677 50 ug
EUR 363
Description: Mouse polyclonal to ESAM

anti-ESAM

YF-PA21678 100 ul
EUR 403
Description: Rabbit polyclonal to ESAM

anti-ESAM

YF-PA21679 100 ug
EUR 403
Description: Rabbit polyclonal to ESAM

ESAM Polyclonal Antibody

27645-100ul 100ul
EUR 252

ESAM Polyclonal Antibody

27645-50ul 50ul
EUR 187

ESAM Rabbit pAb

A12210-100ul 100 ul
EUR 308

ESAM Rabbit pAb

A12210-200ul 200 ul
EUR 459

ESAM Rabbit pAb

A12210-20ul 20 ul
EUR 183

ESAM Rabbit pAb

A12210-50ul 50 ul
EUR 223

ESAM Polyclonal Antibody

ABP58502-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM cloning plasmid

CSB-CL850258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg
  • Show more
Description: A cloning plasmid for the ESAM gene.

ESAM Polyclonal Antibody

A55335 100 µg
EUR 570.55
Description: kits suitable for this type of research

ESAM Polyclonal Antibody

ES11142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Polyclonal Antibody

ES11142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- ESAM antibody

FNab02860 100µg
EUR 548.75
  • Immunogen: endothelial cell adhesion molecule
  • Uniprot ID: Q96AP7
  • Gene ID: 90952
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM

Anti-ESAM antibody

PAab02860 100 ug
EUR 386

Anti-ESAM antibody

STJ114102 100 µl
EUR 277

Anti-ESAM antibody

STJ192300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM

Anti-ESAM (1G8)

YF-MA19632 100 ug
EUR 363
Description: Mouse monoclonal to ESAM

Anti-ESAM (1E4)

YF-MA19633 100 ug
EUR 363
Description: Mouse monoclonal to ESAM

ESAM Antibody, HRP conjugated

1-CSB-PA850258LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ESAM Antibody, FITC conjugated

1-CSB-PA850258LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ESAM Antibody, Biotin conjugated

1-CSB-PA850258LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Esam ELISA KIT

ELI-26041m 96 Tests
EUR 865

ESAM ELISA KIT|Human

EF009449 96 Tests
EUR 689

Rat ESAM shRNA Plasmid

20-abx989060
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ESAM shRNA Plasmid

20-abx976955
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ESAM shRNA Plasmid

20-abx963997
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ESAM Polyclonal Conjugated Antibody

C27645 100ul
EUR 397

Human ESAM ELISA KIT

ELI-32729h 96 Tests
EUR 824

ESAM Recombinant Protein (Human)

RP010933 100 ug Ask for price

ESAM Recombinant Protein (Rat)

RP199946 100 ug Ask for price

ESAM Recombinant Protein (Mouse)

RP132233 100 ug Ask for price

ESAM Polyclonal Antibody, HRP Conjugated

A55336 100 µg
EUR 570.55
Description: fast delivery possible

ESAM Polyclonal Antibody, FITC Conjugated

A55337 100 µg
EUR 570.55
Description: reagents widely cited

ESAM Polyclonal Antibody, Biotin Conjugated

A55338 100 µg
EUR 570.55
Description: Ask the seller for details

Esam ORF Vector (Rat) (pORF)

ORF066650 1.0 ug DNA
EUR 506

ESAM ORF Vector (Human) (pORF)

ORF003645 1.0 ug DNA
EUR 95

Esam ORF Vector (Mouse) (pORF)

ORF044079 1.0 ug DNA
EUR 506

ESAM ELISA Kit (Human) (OKCD00940)

OKCD00940 96 Wells
EUR 831
Description: Description of target: Can mediate aggregation most likely through a homophilic molecular interaction.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

ESAM ELISA Kit (Mouse) (OKCA01663)

OKCA01663 96 Wells
EUR 846
Description: Description of target: Can mediate aggregation most likely through a homophilic molecular interaction.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx103577
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx103578
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx112290
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx125826
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx130223
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx109755
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

20-abx172231
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

abx030442-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

abx030442-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelial Cell Adhesion Molecule (ESAM) Antibody

abx232860-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ESAM sgRNA CRISPR Lentivector set (Human)

K0695901 3 x 1.0 ug
EUR 339

Esam sgRNA CRISPR Lentivector set (Rat)

K7449501 3 x 1.0 ug
EUR 339

Esam sgRNA CRISPR Lentivector set (Mouse)

K3502001 3 x 1.0 ug
EUR 339

Recombinant Endothelial Cell Adhesion Molecule (ESAM)

4-RPE536Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96AP7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Endothelial Cell Adhesion Molecule expressed in: E.coli

Recombinant Endothelial Cell Adhesion Molecule (ESAM)

4-RPE536Mu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q925F2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Endothelial Cell Adhesion Molecule expressed in: E.coli