EIF5A antibody

70R-17064 50 ul
EUR 435
Description: Rabbit polyclonal EIF5A antibody

EIF5A Antibody

32552-100ul 100ul
EUR 252

eIF5A Antibody

48963-100ul 100ul
EUR 333

eIF5A Antibody

48963-50ul 50ul
EUR 239

EIF5A Antibody

DF6754 200ul
EUR 304
Description: EIF5A Antibody detects endogenous levels of total EIF5A.

EIF5A antibody

70R-49699 100 ul
EUR 244
Description: Purified Polyclonal EIF5A antibody

EIF5A antibody

70R-33144 100 ug
EUR 435
Description: Rabbit polyclonal EIF5A antibody

EIF5A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF5A. Recognizes EIF5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF5A Antibody

ABD6754 100 ug
EUR 438

EIF5A Blocking Peptide

DF6754-BP 1mg
EUR 195

Anti-eIF5A Antibody

A01727-1 100ul
EUR 397
Description: Rabbit Polyclonal eIF5A Antibody. Validated in WB and tested in Human, Mouse, Rat.

EIF5A Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

eIF5A Conjugated Antibody

C48963 100ul
EUR 397

EIF5A Conjugated Antibody

C32552 100ul
EUR 397

EIF5A cloning plasmid

CSB-CL007573HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcagatgacttggacttcgagacaggagatgcaggggcctcagccaccttcccaatgcagtgctcagcattacgtaagaatggctttgtggtgctcaaaggccggccatgtaagatcgtcgagatgtctacttcgaagactggcaagcacggccacgccaaggtccatctggt
  • Show more
Description: A cloning plasmid for the EIF5A gene.

eIF5A Rabbit mAb

A4414-100ul 100 ul
EUR 410

eIF5A Rabbit mAb

A4414-200ul 200 ul
EUR 571

eIF5A Rabbit mAb

A4414-20ul 20 ul
EUR 221

eIF5A Rabbit mAb

A4414-50ul 50 ul
EUR 287

EIF5A Rabbit pAb

A2016-100ul 100 ul
EUR 308

EIF5A Rabbit pAb

A2016-200ul 200 ul
EUR 459

EIF5A Rabbit pAb

A2016-20ul 20 ul
EUR 183

EIF5A Rabbit pAb

A2016-50ul 50 ul
EUR 223

anti- EIF5A antibody

FNab02728 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 5A
  • Uniprot ID: P63241
  • Gene ID: 1984
  • Research Area: Metabolism
Description: Antibody raised against EIF5A

Anti-EIF5A antibody

PAab02728 100 ug
EUR 386

pSV40- Eif5a- m

PVT11661 2 ug
EUR 273

Anti-EIF5A antibody

STJ23522 100 µl
EUR 277

Anti-eIF5A antibody

STJ72008 100 µg
EUR 359

Anti-eIF5A (8C1)

YF-MA12806 100 ug
EUR 363
Description: Mouse monoclonal to eIF5A


ELI-20279b 96 Tests
EUR 928


ELI-20280h 96 Tests
EUR 824

Mouse Eif5a ELISA KIT

ELI-20519m 96 Tests
EUR 865


EF009359 96 Tests
EUR 689

Rat EIF5A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF5A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF5A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

eIF5A recombinant monoclonal antibody

A5650 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human eIF5A for WB, IHC,ELISA

EIF5A Recombinant Protein (Human)

RP010498 100 ug Ask for price

EIF5A Recombinant Protein (Rat)

RP199424 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131399 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131402 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131405 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131408 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131411 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131414 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131417 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131420 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131423 100 ug Ask for price

Monoclonal EIF5A Antibody, Clone: 4E10G8

APG03268G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human EIF5A. The antibodies are raised in Mouse and are from clone 4E10G8. This antibody is applicable in WB and IHC, FC, ICC, E

Anti-eIF5A Rabbit Monoclonal Antibody

M01727 100ug/vial
EUR 397
Description: Rabbit Monoclonal eIF5A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Acetylated eIF5A (Lys47) Antibody

P01727 100ul
EUR 397
Description: Rabbit Polyclonal Acetylated eIF5A (Lys47) Antibody. Validated in WB and tested in Human, Mouse, Rat.

Eif5a ORF Vector (Rat) (pORF)

ORF066476 1.0 ug DNA
EUR 506

EIF5A ORF Vector (Human) (pORF)

ORF003500 1.0 ug DNA
EUR 95

Eif5a ORF Vector (Mouse) (pORF)

ORF043801 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043802 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043803 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043804 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043805 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043806 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043807 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043808 1.0 ug DNA
EUR 506

Eif5a ORF Vector (Mouse) (pORF)

ORF043809 1.0 ug DNA
EUR 506

[One Step] EIF5A Antibody Kit

RK05645 50 ul
EUR 240

EIF5A ELISA Kit (Human) (OKEH08524)

OKEH08524 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.163ng/mL

Anti-Acetyl-eIF5A/eIF5A2 (K47) Antibody

A05688 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Acetyl-eIF5A/eIF5A2 (K47) Antibody (EIF5A2) detection.tested for WB in Human, Mouse, Rat.

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47