  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3C Antibody

47321-100ul 100ul
EUR 252

EIF3C antibody

70R-17046 50 ul
EUR 435
Description: Rabbit polyclonal EIF3C antibody

EIF3C Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EIF3C Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

EIF3C Conjugated Antibody

C47321 100ul
EUR 397

anti- EIF3C antibody

FNab02703 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: eukaryotic translation initiation factor 3, subunit C
  • Uniprot ID: Q99613
  • Gene ID: 8663
  • Research Area: Metabolism
Description: Antibody raised against EIF3C

EIF3C Polyclonal Antibody

A67130 100 µg
EUR 570.55
Description: reagents widely cited

EIF3C Rabbit pAb

A7022-100ul 100 ul
EUR 308

EIF3C Rabbit pAb

A7022-200ul 200 ul
EUR 459

EIF3C Rabbit pAb

A7022-20ul 20 ul
EUR 183

EIF3C Rabbit pAb

A7022-50ul 50 ul
EUR 223

EIF3C cloning plasmid

CSB-CL857867HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2742
  • Sequence: atgtcgcggtttttcaccaccggttcggacagcgagtccgagtcgtccttgtccggggaggagctcgtcaccaaacctgtcggaggcaactatggcaaacagccattgttgctgagcgaggatgaagaagataccaagagagttgtccgcagtgccaaggacaagaggtttgagg
  • Show more
Description: A cloning plasmid for the EIF3C gene.

Anti-EIF3C antibody

PAab02703 100 ug
EUR 386


PVT14144 2 ug
EUR 495

Anti-EIF3C antibody

STJ29102 100 µl
EUR 277

Mouse EIF3C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EIF3C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-09999h 96 Tests
EUR 824


ELI-26098b 96 Tests
EUR 928

Mouse Eif3c ELISA KIT

ELI-09164m 96 Tests
EUR 865


EF009339 96 Tests
EUR 689

Human EIF3C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF3C Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3C Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3C Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EIF3C Polyclonal Antibody, HRP Conjugated

A67131 100 µg
EUR 570.55
Description: Ask the seller for details

EIF3C Polyclonal Antibody, FITC Conjugated

A67132 100 µg
EUR 570.55
Description: The best epigenetics products

EIF3C Polyclonal Antibody, Biotin Conjugated

A67133 100 µg
EUR 570.55
Description: kits suitable for this type of research

EIF3C ORF Vector (Human) (pORF)

ORF003466 1.0 ug DNA
EUR 95

Eif3c ORF Vector (Rat) (pORF)

ORF066450 1.0 ug DNA
EUR 506

Eif3c ORF Vector (Mouse) (pORF)

ORF043759 1.0 ug DNA
EUR 506

EIF3C sgRNA CRISPR Lentivector set (Human)

K0667201 3 x 1.0 ug
EUR 339

Eif3c sgRNA CRISPR Lentivector set (Rat)

K6287401 3 x 1.0 ug
EUR 339

Eif3c sgRNA CRISPR Lentivector set (Mouse)

K3973701 3 x 1.0 ug
EUR 339

EIF3C sgRNA CRISPR Lentivector (Human) (Target 1)

K0667202 1.0 ug DNA
EUR 154

EIF3C sgRNA CRISPR Lentivector (Human) (Target 2)

K0667203 1.0 ug DNA
EUR 154

EIF3C sgRNA CRISPR Lentivector (Human) (Target 3)

K0667204 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Rat) (Target 1)

K6287402 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Rat) (Target 2)

K6287403 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Rat) (Target 3)

K6287404 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3973702 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3973703 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3973704 1.0 ug DNA
EUR 154

EIF3C Protein Vector (Mouse) (pPB-C-His)

PV175034 500 ng
EUR 1065

EIF3C Protein Vector (Mouse) (pPB-N-His)

PV175035 500 ng
EUR 1065

EIF3C Protein Vector (Mouse) (pPM-C-HA)

PV175036 500 ng
EUR 1065

EIF3C Protein Vector (Mouse) (pPM-C-His)

PV175037 500 ng
EUR 1065

EIF3C Protein Vector (Human) (pPB-C-His)

PV013861 500 ng
EUR 329

EIF3C Protein Vector (Human) (pPB-N-His)

PV013862 500 ng
EUR 329

EIF3C Protein Vector (Human) (pPM-C-HA)

PV013863 500 ng
EUR 329

EIF3C Protein Vector (Human) (pPM-C-His)

PV013864 500 ng
EUR 329

EIF3C Protein Vector (Rat) (pPB-C-His)

PV265798 500 ng
EUR 1166

EIF3C Protein Vector (Rat) (pPB-N-His)

PV265799 500 ng
EUR 1166

EIF3C Protein Vector (Rat) (pPM-C-HA)

PV265800 500 ng
EUR 1166

EIF3C Protein Vector (Rat) (pPM-C-His)

PV265801 500 ng
EUR 1166

Eif3c 3'UTR Luciferase Stable Cell Line

TU203882 1.0 ml Ask for price

Eif3c 3'UTR GFP Stable Cell Line

TU155715 1.0 ml Ask for price

EIF3C 3'UTR Luciferase Stable Cell Line

TU006730 1.0 ml
EUR 2333

Eif3c 3'UTR Luciferase Stable Cell Line

TU105715 1.0 ml Ask for price

EIF3C 3'UTR GFP Stable Cell Line

TU056730 1.0 ml
EUR 2333

Eif3c 3'UTR GFP Stable Cell Line

TU253882 1.0 ml Ask for price

EIF3C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV687175 1.0 ug DNA
EUR 1355

EIF3C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV687179 1.0 ug DNA
EUR 1355

EIF3C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV687180 1.0 ug DNA
EUR 1355

Eukaryotic Translation Initiation Factor 3 Subunit C (EIF3C) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit C (eIF3C) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit C (EIF3C) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Scroll to Top