EIF2B1

EIF2B1 siRNA

20-abx901673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 Protein

20-abx263439
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 antibody

70R-3849 50 ug
EUR 467
Description: Rabbit polyclonal EIF2B1 antibody raised against the C terminal of EIF2B1

EIF2B1 antibody

70R-17038 50 ul
EUR 435
Description: Rabbit polyclonal EIF2B1 antibody

EIF2B1 Antibody

DF12392 200ul
EUR 304
Description: EIF2B1 antibody detects endogenous levels of EIF2B1.

EIF2B1 Antibody

1-CSB-PA007514GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

EIF2B1 Antibody

1-CSB-PA623910ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF2B1 Antibody

1-CSB-PA623910ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-EIF2B1

YF-PA11516 50 ug
EUR 363
Description: Mouse polyclonal to EIF2B1

anti- EIF2B1 antibody

FNab02693 100µg
EUR 585
  • Immunogen: eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
  • Uniprot ID: Q14232
  • Gene ID: 1967
  • Research Area: Metabolism
Description: Antibody raised against EIF2B1

EIF2B1 Rabbit pAb

A7892-100ul 100 ul
EUR 308

EIF2B1 Rabbit pAb

A7892-200ul 200 ul
EUR 459

EIF2B1 Rabbit pAb

A7892-20ul 20 ul
EUR 183

EIF2B1 Rabbit pAb

A7892-50ul 50 ul
EUR 223

EIF2B1 Blocking Peptide

33R-1107 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACBD5 antibody, catalog no. 70R-6731

EIF2B1 Polyclonal Antibody

31370-100ul 100ul
EUR 252

EIF2B1 Polyclonal Antibody

31370-50ul 50ul
EUR 187

EIF2B1 Blocking Peptide

DF12392-BP 1mg
EUR 195

EIF2B1 cloning plasmid

CSB-CL623910HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: ATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGT
  • Show more
Description: A cloning plasmid for the EIF2B1 gene.

Anti-EIF2B1 antibody

PAab02693 100 ug
EUR 412

pExpress-Eif2b1-r

PVT17590 2 ug
EUR 258

Anti-EIF2B1 antibody

STJ110201 100 µl
EUR 277
Description: This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter.

EIF2B1 Polyclonal Conjugated Antibody

C31370 100ul
EUR 397

Mouse EIF2B1 shRNA Plasmid

20-abx980609
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EIF2B1 shRNA Plasmid

20-abx986264
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2B1 ELISA KIT

ELI-09622h 96 Tests
EUR 824

Bovine EIF2B1 ELISA KIT

ELI-27647b 96 Tests
EUR 928

Mouse Eif2b1 ELISA KIT

ELI-27648m 96 Tests
EUR 865

EIF2B1 ELISA KIT|Human

EF009329 96 Tests
EUR 689

Human EIF2B1 shRNA Plasmid

20-abx951361
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF2B1 protein (His tag)

80R-1781 10 ug
EUR 305
Description: Purified recombinant Human EIF2B1 protein

EIF2B1 Recombinant Protein (Human)

RP038725 100 ug Ask for price

EIF2B1 Recombinant Protein (Rat)

RP199301 100 ug Ask for price

EIF2B1 Recombinant Protein (Mouse)

RP131213 100 ug Ask for price

Eif2b1 ORF Vector (Rat) (pORF)

ORF066435 1.0 ug DNA
EUR 506

Eif2b1 ORF Vector (Mouse) (pORF)

ORF043739 1.0 ug DNA
EUR 506

EIF2B1 ORF Vector (Human) (pORF)

ORF012909 1.0 ug DNA
EUR 354

EIF2B1 sgRNA CRISPR Lentivector set (Human)

K0665501 3 x 1.0 ug
EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Mouse)

K4892101 3 x 1.0 ug
EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Rat)

K7080801 3 x 1.0 ug
EUR 339

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0665502 1.0 ug DNA
EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0665503 1.0 ug DNA
EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0665504 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892102 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892103 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892104 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7080802 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7080803 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7080804 1.0 ug DNA
EUR 154

EIF2B1 Protein Vector (Human) (pPB-C-His)

PV051633 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPB-N-His)

PV051634 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-HA)

PV051635 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-His)

PV051636 500 ng
EUR 481

EIF2B1 Protein Vector (Mouse) (pPB-C-His)

PV174954 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPB-N-His)

PV174955 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-HA)

PV174956 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-His)

PV174957 500 ng
EUR 603

Recombinant Human EIF2B1 Protein, GST, E.coli-100ug

QP7612-ec-100ug 100ug
EUR 408

Recombinant Human EIF2B1 Protein, GST, E.coli-10ug

QP7612-ec-10ug 10ug
EUR 200

Recombinant Human EIF2B1 Protein, GST, E.coli-1mg

QP7612-ec-1mg 1mg
EUR 1632

Recombinant Human EIF2B1 Protein, GST, E.coli-200ug

QP7612-ec-200ug 200ug
EUR 634

Recombinant Human EIF2B1 Protein, GST, E.coli-500ug

QP7612-ec-500ug 500ug
EUR 1060

Recombinant Human EIF2B1 Protein, GST, E.coli-50ug

QP7612-ec-50ug 50ug
EUR 263

EIF2B1 Protein Vector (Rat) (pPB-C-His)

PV265738 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPB-N-His)

PV265739 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-HA)

PV265740 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-His)

PV265741 500 ng
EUR 603

Eif2b1 3'UTR Luciferase Stable Cell Line

TU203867 1.0 ml Ask for price