DYNLL1

DYNLL1 siRNA

20-abx901615
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL1 siRNA

20-abx914811
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL1 siRNA

20-abx914812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL1 antibody

70R-2573 50 ug
EUR 467
Description: Rabbit polyclonal DYNLL1 antibody raised against the N terminal of DYNLL1

DYNLL1 antibody

70R-2617 50 ug
EUR 467
Description: Rabbit polyclonal DYNLL1 antibody raised against the middle region of DYNLL1

DYNLL1 Antibody

ABD2630 100 ug
EUR 438

DYNLL1 Antibody

49177-100ul 100ul
EUR 333

DYNLL1 Antibody

49177-50ul 50ul
EUR 239

DYNLL1 Antibody

33008-100ul 100ul
EUR 252

DYNLL1 Antibody

DF2630 200ul
EUR 304
Description: DYNLL1 antibody detects endogenous levels of total DYNLL1.

DYNLL1 Antibody

1-CSB-PA01284A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

DYNLL1 Antibody

1-CSB-PA244606
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DYNLL1 Antibody

1-CSB-PA078374
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

DYNLL1 Conjugated Antibody

C49177 100ul
EUR 397

DYNLL1 Conjugated Antibody

C33008 100ul
EUR 397

DYNLL1 cloning plasmid

CSB-CL007299HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 270
  • Sequence: ATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGACAAGAAGTACAATCCCACCTGGCATTGCATCGTGGG
  • Show more
Description: A cloning plasmid for the DYNLL1 gene.

DYNLL1 Rabbit pAb

A5742-100ul 100 ul
EUR 308

DYNLL1 Rabbit pAb

A5742-200ul 200 ul
EUR 459

DYNLL1 Rabbit pAb

A5742-20ul 20 ul
EUR 183

DYNLL1 Rabbit pAb

A5742-50ul 50 ul
EUR 223

DYNLL1 Polyclonal Antibody

A53885 100 µg
EUR 570.55
Description: Ask the seller for details

DYNLL1 Rabbit mAb

A4353-100ul 100 ul
EUR 410

DYNLL1 Rabbit mAb

A4353-200ul 200 ul
EUR 571

DYNLL1 Rabbit mAb

A4353-20ul 20 ul
EUR 221

DYNLL1 Rabbit mAb

A4353-50ul 50 ul
EUR 287

DYNLL1 Rabbit pAb

A14496-100ul 100 ul
EUR 308

DYNLL1 Rabbit pAb

A14496-200ul 200 ul
EUR 459

DYNLL1 Rabbit pAb

A14496-20ul 20 ul
EUR 183

DYNLL1 Rabbit pAb

A14496-50ul 50 ul
EUR 223

DYNLL1 Blocking Peptide

33R-5809 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNLL1 antibody, catalog no. 70R-2573

DYNLL1 Blocking Peptide

33R-2498 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNLL1 antibody, catalog no. 70R-2617

DYNLL1 Blocking Peptide

DF2630-BP 1mg
EUR 195

Anti-DYNLL1 antibody

STJ28309 100 µl
EUR 277
Description: Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized.

Anti-DYNLL1 antibody

STJ116707 100 µl
EUR 277
Description: Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized.

Mouse DYNLL1 shRNA Plasmid

20-abx974785
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DYNLL1 shRNA Plasmid

20-abx985931
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYNLL1 shRNA Plasmid

20-abx955692
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYNLL1 protein (His tag)

80R-1506 100 ug
EUR 305
Description: Purified recombinant Human DYNLL1 protein

DYNLL1 recombinant monoclonal antibody

A5640 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human DYNLL1 for WB ,ELISA

DYNLL1 Antibody, HRP conjugated

1-CSB-PA01284B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNLL1 Antibody, FITC conjugated

1-CSB-PA01284C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNLL1 Antibody, Biotin conjugated

1-CSB-PA01284D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYNLL1 Recombinant Protein (Human)

RP038683 100 ug Ask for price

DYNLL1 Recombinant Protein (Rat)

RP198890 100 ug Ask for price

DYNLL1 Recombinant Protein (Mouse)

RP130424 100 ug Ask for price

DYNLL1 Polyclonal Antibody, HRP Conjugated

A53886 100 µg
EUR 570.55
Description: The best epigenetics products

DYNLL1 Polyclonal Antibody, FITC Conjugated

A53887 100 µg
EUR 570.55
Description: kits suitable for this type of research

DYNLL1 Polyclonal Antibody, Biotin Conjugated

A53888 100 µg
EUR 570.55
Description: fast delivery possible

Dynll1 ORF Vector (Rat) (pORF)

ORF066298 1.0 ug DNA
EUR 506

Dynll1 ORF Vector (Mouse) (pORF)

ORF043476 1.0 ug DNA
EUR 506

DYNLL1 ORF Vector (Human) (pORF)

ORF012895 1.0 ug DNA
EUR 354

DYNLL1 sgRNA CRISPR Lentivector set (Human)

K0643801 3 x 1.0 ug
EUR 339

Dynll1 sgRNA CRISPR Lentivector set (Mouse)

K3781001 3 x 1.0 ug
EUR 339

Dynll1 sgRNA CRISPR Lentivector set (Rat)

K6845101 3 x 1.0 ug
EUR 339

Anti-DYNLL1/Pin Rabbit Monoclonal Antibody

M03454 100ug/vial
EUR 397
Description: Rabbit Monoclonal DYNLL1/Pin Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

DYNLL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0643802 1.0 ug DNA
EUR 154

DYNLL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0643803 1.0 ug DNA
EUR 154

DYNLL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0643804 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3781002 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3781003 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3781004 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6845102 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6845103 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6845104 1.0 ug DNA
EUR 154

DYNLL1 Protein Vector (Human) (pPB-C-His)

PV051577 500 ng
EUR 481

DYNLL1 Protein Vector (Human) (pPB-N-His)

PV051578 500 ng
EUR 481

DYNLL1 Protein Vector (Human) (pPM-C-HA)

PV051579 500 ng
EUR 481

DYNLL1 Protein Vector (Human) (pPM-C-His)

PV051580 500 ng
EUR 481

DYNLL1 Protein Vector (Mouse) (pPB-C-His)

PV173902 500 ng
EUR 603

DYNLL1 Protein Vector (Mouse) (pPB-N-His)

PV173903 500 ng
EUR 603