Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

EUR 673
  • Should the Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RDR-DPAGT1-Hu-48Tests 48 Tests
EUR 544

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RDR-DPAGT1-Hu-96Tests 96 Tests
EUR 756

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RD-DPAGT1-Hu-48Tests 48 Tests
EUR 521

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RD-DPAGT1-Hu-96Tests 96 Tests
EUR 723

DPAGT1 Antibody

25355-100ul 100ul
EUR 390


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18256 2 ug
EUR 231

DPAGT1 cloning plasmid

CSB-CL884460HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgtgggccttctcggaattgcccatgccgctgctgatcaatttgatcgtctcgctgctgggatttgtggccacagtcaccctcatcccggccttccggggccacttcattgctgcgcgcctctgtggtcaggacctcaacaaaaccagccgacagcagatcccagaatcccagg
  • Show more
Description: A cloning plasmid for the DPAGT1 gene.


PVT19083 2 ug
EUR 231

Anti-DPAGT1 (1G1)

YF-MA12723 100 ug
EUR 363
Description: Mouse monoclonal to DPAGT1

Mouse DPAGT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DPAGT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPAGT1 Recombinant Protein (Human)

RP009724 100 ug Ask for price

DPAGT1 Recombinant Protein (Rat)

RP198542 100 ug Ask for price

DPAGT1 Recombinant Protein (Mouse)

RP129881 100 ug Ask for price

Dpagt1 ORF Vector (Rat) (pORF)

ORF066182 1.0 ug DNA
EUR 506

DPAGT1 ORF Vector (Human) (pORF)

ORF003242 1.0 ug DNA
EUR 95

Dpagt1 ORF Vector (Mouse) (pORF)

ORF043295 1.0 ug DNA
EUR 506

DPAGT1 ELISA Kit (Human) (OKCD09162)

OKCD09162 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

DPAGT1 ELISA Kit (Human) (OKDD00239)

OKDD00239 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

DPAGT1 sgRNA CRISPR Lentivector set (Human)

K0626301 3 x 1.0 ug
EUR 339

Dpagt1 sgRNA CRISPR Lentivector set (Mouse)

K4848801 3 x 1.0 ug
EUR 339

Dpagt1 sgRNA CRISPR Lentivector set (Rat)

K6619601 3 x 1.0 ug
EUR 339

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx027715-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx027715-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx034594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx034594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0626302 1.0 ug DNA
EUR 154

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0626303 1.0 ug DNA
EUR 154

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0626304 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4848802 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4848803 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4848804 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6619602 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6619603 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6619604 1.0 ug DNA
EUR 154

DPAGT1 Protein Vector (Mouse) (pPB-C-His)

PV173178 500 ng
EUR 603

DPAGT1 Protein Vector (Mouse) (pPB-N-His)

PV173179 500 ng
EUR 603

DPAGT1 Protein Vector (Mouse) (pPM-C-HA)

PV173180 500 ng
EUR 603

DPAGT1 Protein Vector (Mouse) (pPM-C-His)

PV173181 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPB-C-His)

PV264726 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPB-N-His)

PV264727 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPM-C-HA)

PV264728 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPM-C-His)

PV264729 500 ng
EUR 603

DPAGT1 Protein Vector (Human) (pPB-C-His)

PV012965 500 ng
EUR 329

DPAGT1 Protein Vector (Human) (pPB-N-His)

PV012966 500 ng
EUR 329

DPAGT1 Protein Vector (Human) (pPM-C-HA)

PV012967 500 ng
EUR 329

DPAGT1 Protein Vector (Human) (pPM-C-His)

PV012968 500 ng
EUR 329

Dpagt1 3'UTR GFP Stable Cell Line

TU155343 1.0 ml Ask for price

Dpagt1 3'UTR Luciferase Stable Cell Line

TU105343 1.0 ml Ask for price

Dpagt1 3'UTR Luciferase Stable Cell Line

TU203592 1.0 ml Ask for price

Dpagt1 3'UTR GFP Stable Cell Line

TU253592 1.0 ml Ask for price

DPAGT1 3'UTR GFP Stable Cell Line

TU056258 1.0 ml
EUR 2333

DPAGT1 3'UTR Luciferase Stable Cell Line

TU006258 1.0 ml
EUR 2333

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

DPAGT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621085 1.0 ug DNA
EUR 682

DPAGT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621089 1.0 ug DNA
EUR 682

DPAGT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621090 1.0 ug DNA
EUR 682

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 elisa. Alternative names of the recognized antigen: ALG7
  • CDG-Ij
  • DGPT
  • DPAGT2
  • G1PT
  • GPT
  • UAGT
  • UGAT
  • GlcNAc-1-P Transferase
  • UDP-N-acetylglucosamine--dolichyl-phosphate
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human DPAGT1 (Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1)

ELK4380 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1). Standards or samples are then added to the appropriate microtiter plate wells with a bioti
  • Show more
Description: A sandwich ELISA kit for detection of Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.