DCTN6

321  

DCTN6 Antibody
36406-100ul 100ul
EUR 252

DCTN6 Antibody
1-CSB-PA694176
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DCTN6 Antibody
DF12381 200ul
EUR 304
Description: DCTN6 antibody detects endogenous levels of DCTN6.

DCTN6 Antibody
1-CSB-PA572419
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300

DCTN6 Antibody
1-CSB-PA006569ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

DCTN6 Antibody
1-CSB-PA006569ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

DCTN6 Antibody
1-CSB-PA006569GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DCTN6 siRNA
20-abx913705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCTN6 siRNA
20-abx913706
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DCTN6
YF-PA17161 50 ug
EUR 363
Description: Mouse polyclonal to DCTN6

DCTN6 Blocking Peptide
DF12381-BP 1mg
EUR 195

DCTN6 Conjugated Antibody
C36406 100ul
EUR 397

DCTN6 cloning plasmid
CSB-CL006569HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atggcggagaagactcaaaagagtgtgaagattgctcctggagcagttgtatgtgtagaaagtgaaatcagaggagatgtaactatcggacctcggacagtgatccaccctaaagcaagaattattgcggaagccgggccaatagtgattggcgaagggaacctaatagaagaaca
  • Show more
Description: A cloning plasmid for the DCTN6 gene.

DCTN6 Rabbit pAb
A8316-100ul 100 ul
EUR 308

DCTN6 Rabbit pAb
A8316-200ul 200 ul
EUR 459

DCTN6 Rabbit pAb
A8316-20ul 20 ul
EUR 183

DCTN6 Rabbit pAb
A8316-50ul 50 ul
EUR 223

anti- DCTN6 antibody
FNab02276 100µg
EUR 505.25
  • Immunogen: dynactin 6
  • Uniprot ID: O00399
  • Gene ID: 10671
  • Research Area: Metabolism
Description: Antibody raised against DCTN6

Anti-DCTN6 antibody
PAab02276 100 ug
EUR 355

pCMV-SPORT6-DCTN6
PVT13686 2 ug
EUR 391

Anti-DCTN6 antibody
STJ110614 100 µl
EUR 277
Description: The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known.

DCTN6 protein (His tag)
80R-3967 100 ug
EUR 349
Description: Recombinant Human DCTN6 protein

DCTN6 ELISA KIT|Human
EF009032 96 Tests
EUR 689

Mouse DCTN6 shRNA Plasmid
20-abx973414
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal DCTN6 Antibody (Center)
APR07505G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCTN6 (Center). This antibody is tested and proven to work in the following applications:

Human DCTN6 shRNA Plasmid
20-abx957278
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCTN6 Recombinant Protein (Human)
RP008869 100 ug Ask for price

DCTN6 Recombinant Protein (Rat)
RP197501 100 ug Ask for price

DCTN6 Recombinant Protein (Mouse)
RP128192 100 ug Ask for price

Human Dynactin subunit 6 (DCTN6)
1-CSB-EP006569HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dynactin subunit 6(DCTN6) expressed in E.coli

Dynactin Subunit 6 (DCTN6) Antibody
20-abx005907
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
20-abx211691
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
20-abx212864
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
20-abx112191
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
abx029713-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
abx029713-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
20-abx321395
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
20-abx322671
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody
abx232276-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Dctn6 ORF Vector (Rat) (pORF)
ORF065835 1.0 ug DNA
EUR 506

DCTN6 ORF Vector (Human) (pORF)
ORF002957 1.0 ug DNA
EUR 95

Dctn6 ORF Vector (Mouse) (pORF)
ORF042732 1.0 ug DNA
EUR 506

Human Dynactin 6 (DCTN6)ELISA Kit
201-12-2664 96 tests
EUR 440
  • This Dynactin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

DCTN6 sgRNA CRISPR Lentivector set (Human)
K0567701 3 x 1.0 ug
EUR 339

Dctn6 sgRNA CRISPR Lentivector set (Rat)
K6415601 3 x 1.0 ug
EUR 339

Dctn6 sgRNA CRISPR Lentivector set (Mouse)
K3424901 3 x 1.0 ug
EUR 339

DCTN6 Dynactin 6 Human Recombinant Protein
PROTO00399 Regular: 20ug
EUR 317
Description: DCTN6 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 213 amino acids (1-190 a.a) and having a molecular mass of 23.1kDa. DCTN6 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Dynactin 6(DCTN6)ELISA Kit
QY-E03777 96T
EUR 361

Human Dynactin subunit 6, DCTN6 ELISA KIT
ELI-08984h 96 Tests
EUR 824

Bovine Dynactin subunit 6, DCTN6 ELISA KIT
ELI-31033b 96 Tests
EUR 928

Human Dynactin Subunit 6 (DCTN6) ELISA Kit
abx386814-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dynactin subunit 6, Dctn6 ELISA KIT
ELI-47015m 96 Tests
EUR 865

DCTN6 sgRNA CRISPR Lentivector (Human) (Target 1)
K0567702 1.0 ug DNA
EUR 154

DCTN6 sgRNA CRISPR Lentivector (Human) (Target 2)
K0567703 1.0 ug DNA
EUR 154

DCTN6 sgRNA CRISPR Lentivector (Human) (Target 3)
K0567704 1.0 ug DNA
EUR 154

Dctn6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6415602 1.0 ug DNA
EUR 154

Dctn6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6415603 1.0 ug DNA
EUR 154

Dctn6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6415604 1.0 ug DNA
EUR 154

Dctn6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3424902 1.0 ug DNA
EUR 154

Dctn6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3424903 1.0 ug DNA
EUR 154

Dctn6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3424904 1.0 ug DNA
EUR 154

DCTN6 Protein Vector (Mouse) (pPB-C-His)
PV170926 500 ng
EUR 603

DCTN6 Protein Vector (Mouse) (pPB-N-His)
PV170927 500 ng
EUR 603

DCTN6 Protein Vector (Mouse) (pPM-C-HA)
PV170928 500 ng
EUR 603

DCTN6 Protein Vector (Mouse) (pPM-C-His)
PV170929 500 ng
EUR 603

DCTN6 Protein Vector (Rat) (pPB-C-His)
PV263338 500 ng
EUR 603

DCTN6 Protein Vector (Rat) (pPB-N-His)
PV263339 500 ng
EUR 603

DCTN6 Protein Vector (Rat) (pPM-C-HA)
PV263340 500 ng
EUR 603

DCTN6 Protein Vector (Rat) (pPM-C-His)
PV263341 500 ng
EUR 603

DCTN6 Protein Vector (Human) (pPB-C-His)
PV011825 500 ng
EUR 329