
Mobile: 0032476375875

Lab Reagentia

Recente artiekels

Bezoek of bel ons


CNTN4 antibody

70R-16488 50 ul
EUR 435
Description: Rabbit polyclonal CNTN4 antibody

CNTN4 Antibody

46964-100ul 100ul
EUR 252

CNTN4 Antibody

34618-100ul 100ul
EUR 252

CNTN4 Antibody

34618-50ul 50ul
EUR 187

CNTN4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNTN4 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

CNTN4 Antibody

CSB-PA068627-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

CNTN4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CNTN4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CNTN4 antibody

70R-36353 100 ug
EUR 327
Description: Rabbit polyclonal CNTN4 antibody

CNTN4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTN4 Rabbit pAb

A10339-100ul 100 ul
EUR 308

CNTN4 Rabbit pAb

A10339-200ul 200 ul
EUR 459

CNTN4 Rabbit pAb

A10339-20ul 20 ul
EUR 183

CNTN4 Rabbit pAb

A10339-50ul 50 ul
EUR 223

CNTN4 Conjugated Antibody

C34618 100ul
EUR 397

CNTN4 cloning plasmid

CSB-CL810284HU-10ug 10ug
EUR 696
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2094
  • Sequence: atggaagaaaatgtcttttgggaatgtaaagcaaatggaaggcctaagcctacatacaagtggctaaaaaatggcgaacctctgctaactcgggatagaattcaaattgagcaaggaacactcaacataacaatagtgaacctctcagatgctggcatgtatcagtgtttggcag
  • Show more
Description: A cloning plasmid for the CNTN4 gene.

anti- CNTN4 antibody

FNab01822 100µg
EUR 505.25
  • Immunogen: contactin 4
  • Uniprot ID: Q8IWV2
  • Gene ID: 152330
  • Research Area: Neuroscience, Immunology, Developmental biology
Description: Antibody raised against CNTN4

Anti-CNTN4 antibody

PAab01822 100 ug
EUR 355

Anti-CNTN4 antibody

STJ112377 100 µl
EUR 277
Description: This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants.

Anti-CNTN4 (4B10)

YF-MA19959 100 ug
EUR 363
Description: Mouse monoclonal to CNTN4

Contactin 4 (CNTN4) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Contactin 4 (CNTN4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.


EHC0416 96Tests
EUR 521


EGTC0416 96Tests
EUR 521

Bovine CNTN4 ELISA Kit

EBC0416 96Tests
EUR 521

Canine CNTN4 ELISA Kit

ECC0416 96Tests
EUR 521

Anserini CNTN4 ELISA Kit

EAC0416 96Tests
EUR 521


EF006707 96 Tests
EUR 689

Human CNTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CNTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

abx331290-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

abx430919-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Contactin 4 (CNTN4) Antibody

abx231822-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse CNTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EMC0416 96Tests
EUR 521


ERC0416 96Tests
EUR 521

Rabbit CNTN4 ELISA Kit

ERTC0416 96Tests
EUR 521

Porcine CNTN4 ELISA Kit

EPC0416 96Tests
EUR 521

Recombinant Contactin 4 (CNTN4)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IWV2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Contactin 4 expressed in: E.coli

Human Contactin 4 (CNTN4) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea Pig CNTN4 ELISA Kit

EGC0416 96Tests
EUR 521

Cntn4 ORF Vector (Rat) (pORF)

ORF065235 1.0 ug DNA
EUR 506

CNTN4 ORF Vector (Human) (pORF)

ORF002519 1.0 ug DNA
EUR 95

Cntn4 ORF Vector (Mouse) (pORF)

ORF041721 1.0 ug DNA
EUR 506

Cntn4 ORF Vector (Mouse) (pORF)

ORF041722 1.0 ug DNA
EUR 506

Cntn4 ORF Vector (Mouse) (pORF)

ORF041723 1.0 ug DNA
EUR 506

CNTN4 ELISA Kit (Human) (OKCD01572)

OKCD01572 96 Wells
EUR 792
Description: Description of target: Contactins mediate cell surface interactions during nervous system development. Has some neurite outgrowth-promoting activity. May be involved in synaptogenesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL

CNTN4 ELISA Kit (Human) (OKBB01227)

OKBB01227 96 Wells
EUR 505
Description: Description of target: Contactin-4 is a protein that in humans is encoded by the CNTN4 gene. It is mapped to 3p26.3-p26.2. This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Cntn4 ELISA Kit (Mouse) (OKBB01228)

OKBB01228 96 Wells
EUR 505
Description: Description of target: Contactin-4 is a protein that in humans is encoded by the CNTN4 gene. It is mapped to 6; 6 E1. The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

CNTN4 ELISA Kit (Mouse) (OKEI00599)

OKEI00599 96 Wells
EUR 767
Description: Description of target: Contactins mediate cell surface interactions during nervous system development. Has some neurite outgrowth-promoting activity. May be involved in synaptogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

CNTN4 ELISA Kit (Rat) (OKEI00741)

OKEI00741 96 Wells
EUR 767
Description: Description of target: Contactins mediate cell surface interactions during nervous system development. Has some neurite outgrowth-promoting activity. May be involved in synaptogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human Contactin 4 (CNTN4) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Contactin 4 (CNTN4) ELISA Kit

abx256814-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Contactin 4 (CNTN4) ELISA Kit

abx252238-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human CNTN4(Contactin 4) ELISA Kit

EH2852 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8IWV2
  • Alias: CNTN4/Brain-derived immunoglobulin superfamily protein 2(BIG-2)/BIG-2/CNTN4/AXCAM/axonal-associated cell adhesion molecule/BIG-2Brain-derived immunoglobulin superfamily protein 2/contactin 4/
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Contactin- 4, CNTN4 ELISA KIT

ELI-25403h 96 Tests
EUR 824

Pig Contactin 4 (CNTN4) ELISA Kit

abx360557-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Contactin 4 (CNTN4) ELISA Kit

abx363196-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Contactin 4 (CNTN4) ELISA Kit

abx353300-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Contactin 4 (CNTN4) ELISA Kit

abx356717-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.