CHCHD5

CHCHD5 siRNA

20-abx911652
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHCHD5 Antibody

46486-100ul 100ul
EUR 252

CHCHD5 antibody

10R-6847 100 ul
EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody

10R-6848 100 ul
EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody

10R-6849 100 ul
EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody

10R-3676 100 ul
EUR 726
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody

10R-3678 100 ul
EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody

10R-3679 100 ul
EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody

10R-3680 100 ul
EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 Conjugated Antibody

C46486 100ul
EUR 397

CHCHD5 cloning plasmid

CSB-CL861130HU-10ug 10ug
EUR 203
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgcaggcggccctagaggtcaccgctcgctactgtggccgggagctggagcagtatggccagtgtgtggcggccaagccggaatcctggcagcgggactgtcactaccttaagatgagcattgcccagtgcacatcctcccacccaatcatccgccagatccgccaggcctgtgc
  • Show more
Description: A cloning plasmid for the CHCHD5 gene.

Mouse CHCHD5 shRNA Plasmid

20-abx975447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CHCHD5 shRNA Plasmid

20-abx963394
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Chchd5 ELISA KIT

ELI-25361m 96 Tests
EUR 865

Human CHCHD5 ELISA KIT

ELI-25744h 96 Tests
EUR 824

CHCHD5 Recombinant Protein (Human)

RP006961 100 ug Ask for price

CHCHD5 Recombinant Protein (Rat)

RP194786 100 ug Ask for price

CHCHD5 Recombinant Protein (Mouse)

RP123821 100 ug Ask for price

CHCHD5 ORF Vector (Human) (pORF)

ORF002321 1.0 ug DNA
EUR 95

Chchd5 ORF Vector (Mouse) (pORF)

ORF041275 1.0 ug DNA
EUR 506

Chchd5 ORF Vector (Rat) (pORF)

ORF064930 1.0 ug DNA
EUR 506

CHCHD5 sgRNA CRISPR Lentivector set (Human)

K0442001 3 x 1.0 ug
EUR 339

Chchd5 sgRNA CRISPR Lentivector set (Mouse)

K4527601 3 x 1.0 ug
EUR 339

Chchd5 sgRNA CRISPR Lentivector set (Rat)

K6568301 3 x 1.0 ug
EUR 339

CHCHD5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0442002 1.0 ug DNA
EUR 154

CHCHD5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0442003 1.0 ug DNA
EUR 154

CHCHD5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0442004 1.0 ug DNA
EUR 154

Chchd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4527602 1.0 ug DNA
EUR 154

Chchd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4527603 1.0 ug DNA
EUR 154

Chchd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4527604 1.0 ug DNA
EUR 154

Chchd5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6568302 1.0 ug DNA
EUR 154

Chchd5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6568303 1.0 ug DNA
EUR 154

Chchd5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6568304 1.0 ug DNA
EUR 154

CHCHD5 Protein Vector (Human) (pPB-C-His)

PV009281 500 ng
EUR 329

CHCHD5 Protein Vector (Human) (pPB-N-His)

PV009282 500 ng
EUR 329

CHCHD5 Protein Vector (Human) (pPM-C-HA)

PV009283 500 ng
EUR 329

CHCHD5 Protein Vector (Human) (pPM-C-His)

PV009284 500 ng
EUR 329

CHCHD5 Protein Vector (Rat) (pPB-C-His)

PV259718 500 ng
EUR 603

CHCHD5 Protein Vector (Rat) (pPB-N-His)

PV259719 500 ng
EUR 603

CHCHD5 Protein Vector (Rat) (pPM-C-HA)

PV259720 500 ng
EUR 603

CHCHD5 Protein Vector (Rat) (pPM-C-His)

PV259721 500 ng
EUR 603

CHCHD5 Protein Vector (Mouse) (pPB-C-His)

PV165098 500 ng
EUR 603

CHCHD5 Protein Vector (Mouse) (pPB-N-His)

PV165099 500 ng
EUR 603

CHCHD5 Protein Vector (Mouse) (pPM-C-HA)

PV165100 500 ng
EUR 603

CHCHD5 Protein Vector (Mouse) (pPM-C-His)

PV165101 500 ng
EUR 603

Chchd5 3'UTR Luciferase Stable Cell Line

TU202261 1.0 ml Ask for price

Chchd5 3'UTR GFP Stable Cell Line

TU153808 1.0 ml Ask for price

CHCHD5 3'UTR Luciferase Stable Cell Line

TU004321 1.0 ml
EUR 1521

Chchd5 3'UTR Luciferase Stable Cell Line

TU103808 1.0 ml Ask for price

CHCHD5 3'UTR GFP Stable Cell Line

TU054321 1.0 ml
EUR 1521

Chchd5 3'UTR GFP Stable Cell Line

TU252261 1.0 ml Ask for price

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0442005 3 x 1.0 ug
EUR 376

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4527605 3 x 1.0 ug
EUR 376

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6568305 3 x 1.0 ug
EUR 376

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0442006 1.0 ug DNA
EUR 167

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0442007 1.0 ug DNA
EUR 167

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0442008 1.0 ug DNA
EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4527606 1.0 ug DNA
EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4527607 1.0 ug DNA
EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4527608 1.0 ug DNA
EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6568306 1.0 ug DNA
EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6568307 1.0 ug DNA
EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6568308 1.0 ug DNA
EUR 167

Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E06C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E06C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E06C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E02C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E02C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E02C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E03C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E03C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E03C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E04C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E04C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E04C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E01C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E01C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E01C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E07C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E07C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E07C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E08C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E08C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E08C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E09C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E09C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E09C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E05C1660-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E05C1660-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit

E05C1660-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.