CHCHD5 antibody
10R-3678	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody
10R-3679	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody
10R-3680	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody
10R-6847	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody
10R-6848	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 antibody
10R-6849	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CHCHD5 antibody

CHCHD5 Antibody
46486-100ul	SAB	100ul	EUR 252

CHCHD5 siRNA
20-abx911651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHCHD5 siRNA
20-abx911652	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHCHD5 Conjugated Antibody
C46486	SAB	100ul	EUR 397

CHCHD5 cloning plasmid
CSB-CL861130HU-10ug	Cusabio	10ug	EUR 203
Formulation: 10 μg plasmid + 200μl Glycerol Length: 333 Sequence: atgcaggcggccctagaggtcaccgctcgctactgtggccgggagctggagcagtatggccagtgtgtggcggccaagccggaatcctggcagcgggactgtcactaccttaagatgagcattgcccagtgcacatcctcccacccaatcatccgccagatccgccaggcctgtgc Show more
Description: A cloning plasmid for the CHCHD5 gene.

Mouse Chchd5 ELISA KIT
ELI-25361m	Lifescience Market	96 Tests	EUR 865

Human CHCHD5 ELISA KIT
ELI-25744h	Lifescience Market	96 Tests	EUR 824

Mouse CHCHD5 shRNA Plasmid
20-abx975447	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CHCHD5 shRNA Plasmid
20-abx963394	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CHCHD5 Recombinant Protein (Human)
RP006961	ABM	100 ug	Ask for price

CHCHD5 Recombinant Protein (Rat)
RP194786	ABM	100 ug	Ask for price

CHCHD5 Recombinant Protein (Mouse)
RP123821	ABM	100 ug	Ask for price

Chchd5 ORF Vector (Rat) (pORF)
ORF064930	ABM	1.0 ug DNA	EUR 506

CHCHD5 ORF Vector (Human) (pORF)
ORF002321	ABM	1.0 ug DNA	EUR 95

Chchd5 ORF Vector (Mouse) (pORF)
ORF041275	ABM	1.0 ug DNA	EUR 506

CHCHD5 sgRNA CRISPR Lentivector set (Human)
K0442001	ABM	3 x 1.0 ug	EUR 339

Chchd5 sgRNA CRISPR Lentivector set (Rat)
K6568301	ABM	3 x 1.0 ug	EUR 339

Chchd5 sgRNA CRISPR Lentivector set (Mouse)
K4527601	ABM	3 x 1.0 ug	EUR 339

CHCHD5 sgRNA CRISPR Lentivector (Human) (Target 1)
K0442002	ABM	1.0 ug DNA	EUR 154

CHCHD5 sgRNA CRISPR Lentivector (Human) (Target 2)
K0442003	ABM	1.0 ug DNA	EUR 154

CHCHD5 sgRNA CRISPR Lentivector (Human) (Target 3)
K0442004	ABM	1.0 ug DNA	EUR 154

Chchd5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6568302	ABM	1.0 ug DNA	EUR 154

Chchd5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6568303	ABM	1.0 ug DNA	EUR 154

Chchd5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6568304	ABM	1.0 ug DNA	EUR 154

Chchd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4527602	ABM	1.0 ug DNA	EUR 154

Chchd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4527603	ABM	1.0 ug DNA	EUR 154

Chchd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4527604	ABM	1.0 ug DNA	EUR 154

CHCHD5 Protein Vector (Mouse) (pPB-C-His)
PV165098	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Mouse) (pPB-N-His)
PV165099	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Mouse) (pPM-C-HA)
PV165100	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Mouse) (pPM-C-His)
PV165101	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Rat) (pPB-C-His)
PV259718	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Rat) (pPB-N-His)
PV259719	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Rat) (pPM-C-HA)
PV259720	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Rat) (pPM-C-His)
PV259721	ABM	500 ng	EUR 603

CHCHD5 Protein Vector (Human) (pPB-C-His)
PV009281	ABM	500 ng	EUR 329

CHCHD5 Protein Vector (Human) (pPB-N-His)
PV009282	ABM	500 ng	EUR 329

CHCHD5 Protein Vector (Human) (pPM-C-HA)
PV009283	ABM	500 ng	EUR 329

CHCHD5 Protein Vector (Human) (pPM-C-His)
PV009284	ABM	500 ng	EUR 329

Chchd5 3'UTR GFP Stable Cell Line
TU153808	ABM	1.0 ml	Ask for price

Chchd5 3'UTR Luciferase Stable Cell Line
TU103808	ABM	1.0 ml	Ask for price

Chchd5 3'UTR Luciferase Stable Cell Line
TU202261	ABM	1.0 ml	Ask for price

Chchd5 3'UTR GFP Stable Cell Line
TU252261	ABM	1.0 ml	Ask for price

CHCHD5 3'UTR GFP Stable Cell Line
TU054321	ABM	1.0 ml	EUR 1521

CHCHD5 3'UTR Luciferase Stable Cell Line
TU004321	ABM	1.0 ml	EUR 1521

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0442005	ABM	3 x 1.0 ug	EUR 376

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6568305	ABM	3 x 1.0 ug	EUR 376

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4527605	ABM	3 x 1.0 ug	EUR 376

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0442006	ABM	1.0 ug DNA	EUR 167

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0442007	ABM	1.0 ug DNA	EUR 167

CHCHD5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0442008	ABM	1.0 ug DNA	EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6568306	ABM	1.0 ug DNA	EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6568307	ABM	1.0 ug DNA	EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6568308	ABM	1.0 ug DNA	EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4527606	ABM	1.0 ug DNA	EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4527607	ABM	1.0 ug DNA	EUR 167

Chchd5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4527608	ABM	1.0 ug DNA	EUR 167

Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E02C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E02C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E02C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E03C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E03C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E03C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E06C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E06C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E06C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E04C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E04C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E04C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E01C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E01C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E01C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E07C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E07C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E07C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E09C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E09C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E09C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E08C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E08C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E08C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E05C1660-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E05C1660-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) ELISA kit
E05C1660-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Coiled coil helix coiled coil helix domain containing protein 5(CHCHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.