CDC34

CDC34 siRNA

20-abx911134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC34 siRNA

20-abx911135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC34 antibody

70R-49515 100 ul
EUR 244
Description: Purified Polyclonal CDC34 antibody

Cdc34 Antibody

ABD8520 100 ug
EUR 438

Cdc34 Antibody

49217-100ul 100ul
EUR 333

Cdc34 Antibody

49217-50ul 50ul
EUR 239

CDC34 Antibody

32860-100ul 100ul
EUR 252

CDC34 antibody

70R-13983 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CDC34 antibody

CDC34 antibody

70R-10488 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CDC34 antibody

CDC34 antibody

70R-16301 50 ul
EUR 435
Description: Rabbit polyclonal CDC34 antibody

Cdc34 Antibody

DF8520 200ul
EUR 304
Description: Cdc34 Antibody detects endogenous levels of total Cdc34.

CDC34 Antibody

1-CSB-PA924477
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

CDC34 Antibody

1-CSB-PA001505
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CDC34 Antibody

1-CSB-PA005004GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDC34 Antibody

1-CSB-PA005004LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDC34 Antibody

1-CSB-PA005107
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CDC34 Antibody

1-CSB-PA037967
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:100-1:300

pENTR223- CDC34

PVT11490 2 ug
EUR 273

anti-CDC34

YF-PA10843 100 ug
EUR 403
Description: Rabbit polyclonal to CDC34

Cdc34 Conjugated Antibody

C49217 100ul
EUR 397

CDC34 Conjugated Antibody

C32860 100ul
EUR 397

CDC34 Blocking Peptide

AF7590-BP 1mg
EUR 195

CDC34 cloning plasmid

CSB-CL005004HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggctcggccgctagtgcccagctcgcagaaggcgctgctgctggagctcaaggggctgcaggaagagccggtcgagggattccgcgtgacactggtggacgagggcgatctatacaactgggaggtggccatcttcgggccccccaacacctactacgagggcggctacttcaa
  • Show more
Description: A cloning plasmid for the CDC34 gene.

anti- CDC34 antibody

FNab01527 100µg
EUR 505.25
  • Immunogen: cell division cycle 34 homolog(S. cerevisiae)
  • Uniprot ID: P49427
  • Gene ID: 997
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against CDC34

Cdc34 Polyclonal Antibody

ES1929-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc34 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc34 Polyclonal Antibody

ES1929-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc34 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc34 Polyclonal Antibody

ES3919-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc34 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Cdc34 Polyclonal Antibody

ES3919-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc34 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Cdc34 Polyclonal Antibody

ABP52920-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc34
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc34 from Human, Mouse, Rat. This Cdc34 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc34

Cdc34 Polyclonal Antibody

ABP52920-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc34
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc34 from Human, Mouse, Rat. This Cdc34 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc34

Cdc34 Polyclonal Antibody

ABP52920-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc34
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc34 from Human, Mouse, Rat. This Cdc34 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc34

CDC34 Blocking Peptide

20-abx061998
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CDC34 Blocking Peptide

20-abx062390
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Cdc34 Polyclonal Antibody

ABP50930-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc34
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc34 from Human, Mouse, Rat. This Cdc34 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc34

Cdc34 Polyclonal Antibody

ABP50930-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc34
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc34 from Human, Mouse, Rat. This Cdc34 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc34

Cdc34 Polyclonal Antibody

ABP50930-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Cdc34
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc34 from Human, Mouse, Rat. This Cdc34 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Cdc34

CDC34 Polyclonal Antibody

A62230 100 µg
EUR 570.55
Description: Ask the seller for details

CDC34 Rabbit pAb

A5457-100ul 100 ul
EUR 308

CDC34 Rabbit pAb

A5457-200ul 200 ul
EUR 459

CDC34 Rabbit pAb

A5457-20ul 20 ul
EUR 183

CDC34 Rabbit pAb

A5457-50ul 50 ul
EUR 223

CDC34 Blocking Peptide

33R-9159 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC34 antibody, catalog no. 70R-10488

Cdc34 Polyclonal Antibody

41598-100ul 100ul
EUR 252

Cdc34 Polyclonal Antibody

41598-50ul 50ul
EUR 187

Cdc34 Polyclonal Antibody

40715-100ul 100ul
EUR 252

Cdc34 Polyclonal Antibody

40715-50ul 50ul
EUR 187

Cdc34 Blocking Peptide

DF8520-BP 1mg
EUR 195

Anti-CDC34 antibody

PAab01527 100 ug
EUR 355

Anti-Cdc34 Antibody

PA1444 100ug/vial
EUR 334

Anti-Cdc34 antibody

STJ92168 200 µl
EUR 197
Description: Rabbit polyclonal to Cdc34.

Anti-Cdc34 antibody

STJ96554 200 µl
EUR 197
Description: Rabbit polyclonal to Cdc34.

Anti-CDC34 antibody

STJ27410 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the ubiquitin-conjugating enzyme family. Ubiquitin-conjugating enzyme catalyzes the covalent attachment of ubiquitin to other proteins. This protein is a part of the large multiprotein complex, which is required for ubiquitin-mediated degradation of cell cycle G1 regulators, and for the initiation of DNA replication.

Mouse CDC34 shRNA Plasmid

20-abx980974
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-CDC34(Ser71) Antibody

AF7090 200ul
EUR 376
Description: Phospho-CDC34(Ser71) Antibody detects endogenous levels of CDC34 only when phosphorylated at Ser71.

CDC34 ELISA KIT|Human

EF008547 96 Tests
EUR 689

Human CDC34 shRNA Plasmid

20-abx950711
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDC34 protein (His tag)

80R-1472 100 ug
EUR 349
Description: Purified recombinant Human CDC34 protein

CDC34 recombinant monoclonal antibody

A5198 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human CDC34 for WB, IF,ELISA

CDC34 (Phospho-Ser71) Antibody

12955-100ul 100ul
EUR 252

CDC34 (Phospho-Ser71) Antibody

12955-50ul 50ul
EUR 187

Human recombinant UBE2R1 (CDC34)

6436-3
EUR 365

CDC34 Antibody, HRP conjugated

1-CSB-PA005004LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDC34 Antibody, FITC conjugated

1-CSB-PA005004LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDC34 Antibody, Biotin conjugated

1-CSB-PA005004LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC34. Recognizes CDC34 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDC34 Recombinant Protein (Human)

RP006502 100 ug Ask for price

pCMV-Myc-CDC34 Plasmid

PVTB00673-2a 2 ug
EUR 356

CDC34 Recombinant Protein (Rat)

RP194114 100 ug Ask for price

CDC34 Recombinant Protein (Mouse)

RP122834 100 ug Ask for price

Phospho-CDC34(Ser71) Blocking Peptide

AF7090-BP 1mg
EUR 195

CDC34 Polyclonal Antibody, HRP Conjugated

A62231 100 µg
EUR 570.55
Description: The best epigenetics products

CDC34 Polyclonal Antibody, FITC Conjugated

A62232 100 µg
EUR 570.55
Description: kits suitable for this type of research

CDC34 Polyclonal Antibody, Biotin Conjugated

A62233 100 µg
EUR 570.55
Description: fast delivery possible

CDC34 ORF Vector (Human) (pORF)

ORF002168 1.0 ug DNA
EUR 95

Cdc34 ORF Vector (Mouse) (pORF)

ORF040946 1.0 ug DNA
EUR 506

Cdc34 ORF Vector (Rat) (pORF)

ORF064706 1.0 ug DNA
EUR 506

CDC34 (Phospho-Ser71) Polyclonal Conjugated Antibody

C12955 100ul
EUR 397

CDC34 sgRNA CRISPR Lentivector set (Human)

K0411301 3 x 1.0 ug
EUR 339

Cell Division Cycle 34 (CDC34) Antibody

20-abx111529
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx141300
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (Cdc34) Antibody

abx149123-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx009464
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx004178
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx327208
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx327534
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx301153
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx212177
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

20-abx212547
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 34 (CDC34) Antibody

abx231527-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cdc34 sgRNA CRISPR Lentivector set (Mouse)

K4717001 3 x 1.0 ug
EUR 339

Cdc34 sgRNA CRISPR Lentivector set (Rat)

K7199101 3 x 1.0 ug
EUR 339